ID: 1181177007

View in Genome Browser
Species Human (GRCh38)
Location 22:21043674-21043696
Sequence CTCTGCTCCTCTGATTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181177007_1181177014 0 Left 1181177007 22:21043674-21043696 CCCTGGGAATCAGAGGAGCAGAG No data
Right 1181177014 22:21043697-21043719 GTGGGTGGAAGTTAAGGCTGTGG No data
1181177007_1181177017 13 Left 1181177007 22:21043674-21043696 CCCTGGGAATCAGAGGAGCAGAG No data
Right 1181177017 22:21043710-21043732 AAGGCTGTGGATAAGCTGGGTGG No data
1181177007_1181177015 9 Left 1181177007 22:21043674-21043696 CCCTGGGAATCAGAGGAGCAGAG No data
Right 1181177015 22:21043706-21043728 AGTTAAGGCTGTGGATAAGCTGG No data
1181177007_1181177016 10 Left 1181177007 22:21043674-21043696 CCCTGGGAATCAGAGGAGCAGAG No data
Right 1181177016 22:21043707-21043729 GTTAAGGCTGTGGATAAGCTGGG No data
1181177007_1181177019 17 Left 1181177007 22:21043674-21043696 CCCTGGGAATCAGAGGAGCAGAG No data
Right 1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG No data
1181177007_1181177013 -6 Left 1181177007 22:21043674-21043696 CCCTGGGAATCAGAGGAGCAGAG No data
Right 1181177013 22:21043691-21043713 GCAGAGGTGGGTGGAAGTTAAGG No data
1181177007_1181177020 23 Left 1181177007 22:21043674-21043696 CCCTGGGAATCAGAGGAGCAGAG No data
Right 1181177020 22:21043720-21043742 ATAAGCTGGGTGGAGGGAAGAGG No data
1181177007_1181177018 16 Left 1181177007 22:21043674-21043696 CCCTGGGAATCAGAGGAGCAGAG No data
Right 1181177018 22:21043713-21043735 GCTGTGGATAAGCTGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181177007 Original CRISPR CTCTGCTCCTCTGATTCCCA GGG (reversed) Intergenic
No off target data available for this crispr