ID: 1181177008

View in Genome Browser
Species Human (GRCh38)
Location 22:21043675-21043697
Sequence CCTCTGCTCCTCTGATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181177008_1181177015 8 Left 1181177008 22:21043675-21043697 CCTGGGAATCAGAGGAGCAGAGG No data
Right 1181177015 22:21043706-21043728 AGTTAAGGCTGTGGATAAGCTGG No data
1181177008_1181177019 16 Left 1181177008 22:21043675-21043697 CCTGGGAATCAGAGGAGCAGAGG No data
Right 1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG No data
1181177008_1181177016 9 Left 1181177008 22:21043675-21043697 CCTGGGAATCAGAGGAGCAGAGG No data
Right 1181177016 22:21043707-21043729 GTTAAGGCTGTGGATAAGCTGGG No data
1181177008_1181177018 15 Left 1181177008 22:21043675-21043697 CCTGGGAATCAGAGGAGCAGAGG No data
Right 1181177018 22:21043713-21043735 GCTGTGGATAAGCTGGGTGGAGG No data
1181177008_1181177020 22 Left 1181177008 22:21043675-21043697 CCTGGGAATCAGAGGAGCAGAGG No data
Right 1181177020 22:21043720-21043742 ATAAGCTGGGTGGAGGGAAGAGG No data
1181177008_1181177017 12 Left 1181177008 22:21043675-21043697 CCTGGGAATCAGAGGAGCAGAGG No data
Right 1181177017 22:21043710-21043732 AAGGCTGTGGATAAGCTGGGTGG No data
1181177008_1181177013 -7 Left 1181177008 22:21043675-21043697 CCTGGGAATCAGAGGAGCAGAGG No data
Right 1181177013 22:21043691-21043713 GCAGAGGTGGGTGGAAGTTAAGG No data
1181177008_1181177014 -1 Left 1181177008 22:21043675-21043697 CCTGGGAATCAGAGGAGCAGAGG No data
Right 1181177014 22:21043697-21043719 GTGGGTGGAAGTTAAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181177008 Original CRISPR CCTCTGCTCCTCTGATTCCC AGG (reversed) Intergenic
No off target data available for this crispr