ID: 1181177019

View in Genome Browser
Species Human (GRCh38)
Location 22:21043714-21043736
Sequence CTGTGGATAAGCTGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181177008_1181177019 16 Left 1181177008 22:21043675-21043697 CCTGGGAATCAGAGGAGCAGAGG No data
Right 1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG No data
1181177007_1181177019 17 Left 1181177007 22:21043674-21043696 CCCTGGGAATCAGAGGAGCAGAG No data
Right 1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181177019 Original CRISPR CTGTGGATAAGCTGGGTGGA GGG Intergenic
No off target data available for this crispr