ID: 1181177689

View in Genome Browser
Species Human (GRCh38)
Location 22:21047129-21047151
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 2, 1: 0, 2: 0, 3: 22, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181177689_1181177694 20 Left 1181177689 22:21047129-21047151 CCCAGGTTGTCCAGCTTTCTTTT 0: 2
1: 0
2: 0
3: 22
4: 312
Right 1181177694 22:21047172-21047194 GAAAAGATTTGCGTTGCCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 131
1181177689_1181177692 -2 Left 1181177689 22:21047129-21047151 CCCAGGTTGTCCAGCTTTCTTTT 0: 2
1: 0
2: 0
3: 22
4: 312
Right 1181177692 22:21047150-21047172 TTGATAGCCGTATGACTTTAAGG 0: 1
1: 0
2: 2
3: 8
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181177689 Original CRISPR AAAAGAAAGCTGGACAACCT GGG (reversed) Intronic
903221509 1:21872255-21872277 AAAAGAGAGCTGGGCACCCTCGG + Exonic
904625586 1:31800124-31800146 AGGAGAAGGCTGGAAAACCTTGG + Exonic
904952849 1:34258077-34258099 AAAGGAAAGATGGGCAACTTTGG + Intergenic
908472046 1:64453718-64453740 AAAAGAAAACTAGAAAACCAAGG + Intergenic
909500836 1:76333657-76333679 AAAGGAAATATGGACAACCAAGG - Intronic
910108597 1:83657952-83657974 AAATGAAAGTGGGACAACCAAGG + Intergenic
910276534 1:85454999-85455021 AAAAGGGAGCTGGAAAACCAGGG + Intronic
910536006 1:88298439-88298461 AACTGAAAGATAGACAACCTGGG - Intergenic
910704404 1:90112151-90112173 AACAGAAAGCTGTACAAAGTAGG - Intergenic
911661474 1:100506745-100506767 AAAATTAAGCTGAACAACCAGGG - Intronic
912765187 1:112402553-112402575 AAAAGAAAGAAGCACAAACTGGG + Intronic
912780159 1:112538961-112538983 GAAACAATGCTGTACAACCTCGG - Intronic
913066259 1:115258284-115258306 AAAAGCAAGCTGGAGAACAATGG - Intergenic
914471792 1:147985983-147986005 AAAAGAAAGATGGAGGACATAGG + Intronic
916041321 1:160963962-160963984 AAAGGAGAGCAGGAGAACCTAGG - Intergenic
916061773 1:161103711-161103733 AAAAGAAAGTTGGTCAAAGTTGG + Intronic
916307458 1:163354009-163354031 AAAAGAAAGCTGAATAAATTTGG - Intronic
916330795 1:163614332-163614354 AAAACAAAGCTTGACAAAATGGG - Intergenic
916600727 1:166290825-166290847 AAAACAAAGCTAGATAAGCTGGG - Intergenic
916989570 1:170227688-170227710 AAAAGATAGGTGGAAAACCATGG + Intergenic
917076003 1:171205728-171205750 AAGAAAAAGTTTGACAACCTTGG + Intronic
917691701 1:177476644-177476666 AAAAGAAACCTAGAAATCCTAGG + Intergenic
918920355 1:190701538-190701560 AAAAGAGAGCTGTACTGCCTAGG + Intergenic
920075400 1:203332787-203332809 AAAAGAAAAGGGGACATCCTGGG - Intergenic
920508648 1:206534739-206534761 AAAAGAAACCTGGGAAACCCAGG - Intronic
921246716 1:213251088-213251110 AAAAAAAAGCTGAAAAACCTGGG - Intronic
921712866 1:218390216-218390238 AAAAGAAAGCAGGAAAGCTTTGG + Intronic
921954706 1:220970184-220970206 AGAAGTGAGCTGCACAACCTTGG + Intergenic
922337858 1:224632360-224632382 GAAAGGAAGCAGGATAACCTAGG - Intronic
1063163136 10:3434490-3434512 AAAAGAAAGGTGGACAGAATGGG - Intergenic
1063334331 10:5197015-5197037 AACACAAAGCTGAACAACCCAGG - Intronic
1064348065 10:14550653-14550675 AAATGAAAGCATGACAACTTGGG - Intronic
1066298648 10:34077694-34077716 AAAAAAAATCTGCACAACCAGGG - Intergenic
1067142393 10:43668315-43668337 ACTTGAAAGCTGGACAACCCAGG - Intergenic
1068154234 10:53176069-53176091 AAAAAAAATCTAGATAACCTTGG + Intergenic
1068323058 10:55445258-55445280 AAAAAAAAGCAGGAAAACCAAGG - Intronic
1068669896 10:59711805-59711827 AAAAGAAATCTGGGAAAACTTGG - Intronic
1068839976 10:61601063-61601085 ATCTGAAAGCTGGACACCCTAGG + Intergenic
1069209343 10:65736367-65736389 AAAAGAAAGCTGGGCATGGTGGG - Intergenic
1069932519 10:71892235-71892257 GAAAGAAAGTGGGACAAACTAGG - Intergenic
1070230383 10:74559792-74559814 AAAAGAAAGCTAGGCAAACAAGG - Intronic
1072549667 10:96468052-96468074 AAAAGGAAGCTGGGCTACCCCGG + Intronic
1073055413 10:100697399-100697421 AAAAGAAAGCTGCATATCCAAGG + Intergenic
1073598577 10:104824010-104824032 AAAAGAAAACTGTAGAAGCTGGG + Intronic
1074052458 10:109892456-109892478 TAAAGCAAGCTGGACAAGGTGGG - Intronic
1074657400 10:115608773-115608795 AGATTAAAGCTGGACAACTTTGG + Intronic
1075137710 10:119800615-119800637 AAAAGAGAGCTGGACAAAAGAGG + Intronic
1075400185 10:122155500-122155522 AGAAGAAAGATGGATAACATTGG + Intronic
1075826707 10:125363122-125363144 AAAATAAAGATGGACACCTTCGG - Intergenic
1079604941 11:22353790-22353812 AAAACAAAGCTAGACAAAGTTGG - Intronic
1080597858 11:33791369-33791391 AAAAGAAAAATGGCCAGCCTAGG - Intergenic
1084644481 11:70447045-70447067 CAGAGAAAGATGGACAAGCTGGG - Intergenic
1086200565 11:84196360-84196382 AAAAGAAATCAGGACATTCTAGG + Intronic
1086993726 11:93333044-93333066 GAAAGAAAGCTGCACAAGTTTGG + Intronic
1087020113 11:93594166-93594188 AAAAGAAAATTGAACAACCTTGG - Intergenic
1087030460 11:93698790-93698812 AAATGAAAGCTGTACCAACTGGG - Exonic
1087935052 11:104023934-104023956 GAAAAAAAGGTGGACAAACTTGG + Intronic
1088960016 11:114653821-114653843 AAAAGAAAGCAGGACAGGCCAGG - Intergenic
1089225686 11:116919200-116919222 AAAAGAAAGGTTGGAAACCTTGG - Intronic
1089287803 11:117419033-117419055 AAAAGAAAGCGAGAGAGCCTTGG + Intergenic
1090279266 11:125442228-125442250 CAAAGAAAGCTGGGCGTCCTGGG + Intergenic
1092697420 12:11188845-11188867 AAAAGAAATTTGGACCACATGGG + Intergenic
1092975567 12:13741430-13741452 CATAGAAAGATGGATAACCTGGG + Intronic
1093135173 12:15440659-15440681 AAAACAAGCCTGGACAACATAGG + Intronic
1093589161 12:20879299-20879321 AAGAGAAGGGTGGAGAACCTGGG - Intronic
1094079181 12:26513637-26513659 AAGAGAAACCTGGAAAACTTGGG - Intronic
1094594895 12:31856300-31856322 TAAAGCAAGATGGACCACCTTGG + Intergenic
1097987848 12:65803178-65803200 CATAGAAAGCTGGAAATCCTAGG - Intergenic
1099519532 12:83642975-83642997 AAAGGAAATCTGGAAAATCTAGG - Intergenic
1099546271 12:83984127-83984149 AAAAGAAACCTGGGAAACTTGGG + Intergenic
1099983283 12:89631800-89631822 AAAAAAAAGTTGTATAACCTTGG - Intronic
1100009732 12:89938753-89938775 AAAAAATAGCTGGGCAACCCTGG + Intergenic
1102693760 12:114782034-114782056 ATAAGAAAGCAGGCCAACGTGGG + Intergenic
1102975178 12:117201747-117201769 AAAGGAAAGCTGGCCAAGCGTGG - Intergenic
1103353874 12:120305181-120305203 AAAAGAAAGTTGAGCAAGCTAGG + Intronic
1105253482 13:18722501-18722523 AAAAGAAAGTTAAACAACTTTGG - Intergenic
1106915772 13:34512547-34512569 ATAAGAAAACTGGACAACCAAGG - Intergenic
1107894143 13:44942251-44942273 AAAAGAAAGCTAGAAATCCCTGG + Intronic
1108177586 13:47809229-47809251 AAAAAAAAGCAGGAGAAACTGGG + Intergenic
1111656617 13:91162071-91162093 AAAAGACAGCTGAACCATCTGGG + Intergenic
1111858956 13:93676824-93676846 GAATAAAAGCTGGAAAACCTGGG + Intronic
1112371541 13:98798157-98798179 GAAAGAAGGCTGGACACACTGGG + Intronic
1112801145 13:103110846-103110868 GAAAGAAATCTAGACAACATTGG + Intergenic
1116569129 14:46492600-46492622 AAAAGGATCCTGGACAACCATGG + Intergenic
1117027748 14:51638602-51638624 AGGAGAAAGTTGGACAATCTGGG - Intronic
1117529574 14:56646142-56646164 AAAAGGAAGCTGGACAACTGAGG + Intronic
1117569607 14:57033726-57033748 AATAGAAAGCTGACCACCCTGGG + Intergenic
1119501046 14:75127418-75127440 AAAAGAATGCTGTCCAACGTTGG - Intergenic
1120615509 14:86699148-86699170 TAAAGAAAGCTGCAGAAACTAGG + Intergenic
1121237624 14:92404233-92404255 AAAAGAAAGCAAGACCAGCTGGG - Intronic
1122529421 14:102415469-102415491 AAAAGACAACTGGAACACCTGGG + Intronic
1124682537 15:31747340-31747362 AAAAGAAAGCAGAACTTCCTAGG + Intronic
1125217422 15:37291180-37291202 AAATGAAAGCTAGATCACCTAGG - Intergenic
1126781455 15:52142685-52142707 AAAAGAAAGCAGGGCACCTTAGG - Intronic
1128028481 15:64460047-64460069 AAGAGAAAGCTGGAGAACAAAGG + Intergenic
1128488385 15:68120101-68120123 AAAACAAAGCTGGATGACCTGGG - Intronic
1130315119 15:82788680-82788702 AAGAGCAAGCTTGGCAACCTGGG + Intronic
1130867021 15:87941980-87942002 AAATGAAAGCTGCAGATCCTGGG + Intronic
1131040163 15:89257194-89257216 AAAAGAAATCTGGCCAAGCGTGG - Intronic
1131398265 15:92104225-92104247 AAAAGAAGGCTGGACCACTGGGG - Intronic
1135332430 16:21571871-21571893 AAGAGAAAGCTGCAGAACATTGG + Intergenic
1135764602 16:25166609-25166631 AAAATAAAACTGACCAACCTGGG - Intronic
1136036770 16:27546459-27546481 AAAAAAAAACTTGACAAGCTTGG - Intronic
1136125683 16:28178605-28178627 AAAAAAAAACTCGACAACTTAGG + Intronic
1137505841 16:49052999-49053021 AACACAAGGCTGGACACCCTCGG - Intergenic
1137744230 16:50809232-50809254 AAAAGAGACCTGGCCATCCTGGG + Intergenic
1139441047 16:66967020-66967042 AAAACAAAGCTGGGTGACCTTGG - Intronic
1140837268 16:78806712-78806734 AATAGAATGCAGGAAAACCTAGG - Intronic
1141478288 16:84288593-84288615 AAAAGAAAGCAGGACAAAGGGGG + Intergenic
1142786758 17:2230384-2230406 AAACGAAATCTGGGCAACATGGG + Intronic
1143090533 17:4446959-4446981 AAAAGGAAGCTGGACTCACTCGG - Exonic
1143651427 17:8266200-8266222 AGAAGAAAGCTCAGCAACCTCGG - Intronic
1143960750 17:10716545-10716567 AAAAGAAAGCTGCACCACCGCGG + Intronic
1144006172 17:11101835-11101857 AAAAGAATTCTGGAAAACGTAGG - Intergenic
1144182441 17:12764723-12764745 AAAAGAAAGATGGCCAAACGAGG - Exonic
1144190653 17:12842515-12842537 AAATGAAAGTTGGAGAACCACGG - Intronic
1146300117 17:31681653-31681675 ATAAGAAAGCTTGACAATATTGG + Intergenic
1148822678 17:50368984-50369006 AGAATAATGCTGGACTACCTGGG - Intronic
1150047877 17:61931039-61931061 AAAAGCAAGCTGGTCAAGCCAGG - Intergenic
1150723503 17:67633363-67633385 AAAAGAAATCTGAACCACGTCGG - Intronic
1151759703 17:76093602-76093624 AAAAGAAAGCTGGAGAAGCCGGG - Intronic
1152308410 17:79534768-79534790 AAAAGAAACCTGAATAAACTGGG - Intergenic
1153130700 18:1852369-1852391 AAAATAAATCAGGACTACCTAGG - Intergenic
1153432467 18:5032944-5032966 AGAAGAAAGCTCCACAACTTTGG - Intergenic
1154317255 18:13314518-13314540 AAAAGAAAGGTGGCCAACACTGG + Intronic
1156710378 18:39936998-39937020 ACAAGAAATCAGAACAACCTTGG - Intergenic
1156893541 18:42216910-42216932 AAAAGAAAGACGTTCAACCTTGG - Intergenic
1157282144 18:46353241-46353263 GAATGAAAGCTGCACATCCTTGG + Intronic
1157576731 18:48748674-48748696 ACTTGAAAGCTGGACACCCTTGG - Intronic
1157669030 18:49512795-49512817 AGAAGAAAACTGGACAATCCAGG + Intergenic
1157745368 18:50130421-50130443 GAAGGAAACCTGTACAACCTTGG + Intronic
1157779191 18:50422151-50422173 AAAAGAAACTTGGGCATCCTTGG + Intergenic
1158538395 18:58329172-58329194 AAAATCAAGCTGGAGAACATGGG - Intronic
1159473999 18:68893859-68893881 AAAAGGAAACTGGACAAACACGG - Intronic
1160392148 18:78542007-78542029 AAAAGAAAGCAGAAAAGCCTCGG - Intergenic
1160393143 18:78551381-78551403 AAAAGAAAGCGGGAAAATATAGG + Intergenic
1163476266 19:17527757-17527779 AAAAGCAAACTGGCCAACATAGG - Intronic
1167295055 19:48645074-48645096 AAGAGAAGGCTGGACAAGGTGGG + Intronic
1167427775 19:49438317-49438339 AAGAGAAAGATGGAGAGCCTGGG + Intronic
924961788 2:42170-42192 AAAAGAAAGCTGGATGTCCCGGG + Intronic
924999331 2:392541-392563 AACTGAAAGCTGGACATGCTGGG - Intergenic
925853407 2:8106158-8106180 AAAATGAACCTGGACATCCTGGG + Intergenic
926313412 2:11691870-11691892 AAAGGATAGTTGGATAACCTGGG - Intronic
927969091 2:27293100-27293122 AAAAGAAAGCTTGACAAACAAGG - Intronic
928157033 2:28886254-28886276 CAAAGAAGGCTGGACAGGCTGGG + Intergenic
931076368 2:58717740-58717762 AAACGAAATCTGGACAAGATAGG + Intergenic
932363411 2:71129731-71129753 AACAGAAAGCTGGTCACGCTTGG + Intronic
932943328 2:76195798-76195820 ATAAGACAGCAAGACAACCTGGG - Intergenic
935132235 2:100269242-100269264 AAAGGAGAGCTGGCCAATCTGGG - Intergenic
936003535 2:108860499-108860521 AAAAAAAACCTCAACAACCTAGG - Intronic
936430275 2:112456648-112456670 AAAAGAGAGCTGGACCATCTGGG + Intergenic
936647907 2:114393077-114393099 AAAACCAAGCTGTACCACCTTGG - Intergenic
937918695 2:127114807-127114829 CAAGGAAAGCTGGACAGGCTGGG - Intergenic
939187147 2:138874344-138874366 AAAACAAAACTGGACAAAATTGG - Intergenic
939708793 2:145488965-145488987 AAAGGAAAGCTGGAAATCCTTGG + Intergenic
940083655 2:149833339-149833361 AAATGAAAGCTGCATATCCTTGG - Intergenic
940294267 2:152105958-152105980 AGAAGAAATCAGGGCAACCTTGG + Intergenic
941383888 2:164829717-164829739 AAAATAAAACTGGAAAATCTGGG - Intronic
941475200 2:165942769-165942791 AAAATACAGCTGGAAAAGCTAGG - Intronic
942225196 2:173808737-173808759 GACCAAAAGCTGGACAACCTGGG + Intergenic
942800068 2:179864216-179864238 GGAAGAAAACTGGACTACCTAGG + Intergenic
943015850 2:182509775-182509797 AAGACAAAGCTGAACAACTTTGG - Intronic
943662827 2:190577530-190577552 ACAAGAAAGCTGGGCAACTGTGG + Intergenic
944021425 2:195109744-195109766 AAAAAAAACCTGGTCAGCCTTGG + Intergenic
945327805 2:208502860-208502882 AAAGAAAACCTTGACAACCTTGG - Intronic
946044274 2:216808151-216808173 AAATGAAAACTGGGCAACTTGGG - Intergenic
947066198 2:226228238-226228260 TAAGGAAAGTTGGACAAGCTTGG - Intergenic
948427003 2:237894718-237894740 AAAAGCCACCTGGACAGCCTGGG - Intronic
948530867 2:238603177-238603199 AACAGAAAGCCTGTCAACCTTGG + Intergenic
1169061668 20:2664848-2664870 AAAAAAAGCCTGGACAACATAGG + Intergenic
1169466192 20:5842171-5842193 CAAGGATAGCTGGACTACCTTGG + Intronic
1169640514 20:7745624-7745646 AGAAACAAGCTGGAAAACCTAGG + Intergenic
1170121524 20:12917586-12917608 AAAAGAAATCTGGACACCCGAGG + Intergenic
1171297969 20:24035334-24035356 ATAAGAACACTGGACAATCTTGG - Intergenic
1171997107 20:31740016-31740038 AAAAGAGAGCTGGACAAATATGG - Intronic
1172472419 20:35209697-35209719 AAAAGAAGACTGGTCAACCATGG + Intergenic
1174413112 20:50348864-50348886 AAAAAAAAGATGGAGATCCTGGG - Intergenic
1176338465 21:5620813-5620835 AAAGGAGAGCTGCATAACCTGGG - Intergenic
1176339873 21:5683886-5683908 AAAGGAGAGCTGCATAACCTGGG - Intergenic
1176472127 21:7116039-7116061 AAAGGAGAGCTGCATAACCTGGG - Intergenic
1176495688 21:7497817-7497839 AAAGGAGAGCTGCATAACCTGGG - Intergenic
1176504954 21:7640570-7640592 AAAGGAGAGCTGCATAACCTGGG + Intergenic
1177365074 21:20124249-20124271 AAAAGAAAGCAGATTAACCTTGG - Intergenic
1177858983 21:26430430-26430452 AAACTAAAAATGGACAACCTAGG - Intergenic
1179839195 21:44059615-44059637 AAAAGAAAGATGAACACCCAAGG - Intronic
1180882727 22:19217865-19217887 AAAAGAAAGAAAGAAAACCTTGG + Intronic
1181171664 22:21013390-21013412 AAAAGAAAGCTGGACAACCTGGG + Intronic
1181177689 22:21047129-21047151 AAAAGAAAGCTGGACAACCTGGG - Intronic
1182875105 22:33684876-33684898 AAATGAAAGGTGAACAACCTTGG - Intronic
1182915695 22:34027852-34027874 AAAGGAAAGCTGGACAAAAGGGG - Intergenic
1183835024 22:40445235-40445257 AAAAGATAACTGGTCAATCTAGG - Intronic
950048998 3:9971852-9971874 AAAAGAAAAATGGACAAAATGGG - Intronic
951016605 3:17739350-17739372 AAAAGTAAGAAGGACAACCCCGG - Intronic
952924267 3:38309720-38309742 AAAAGAAAGAAGGTTAACCTTGG + Intronic
954860652 3:53687527-53687549 AAAAATAAGCTGGAGAAACTGGG + Intronic
954989543 3:54828625-54828647 AATATAATGCTGGACAATCTTGG - Intronic
955248787 3:57255923-57255945 AAAATAATTCTGGATAACCTAGG - Intronic
955281202 3:57596792-57596814 TATTGAAAGCTGGACAACATTGG - Intronic
955594288 3:60572008-60572030 AAAAGAAAGAAAGAAAACCTTGG - Intronic
956088257 3:65636653-65636675 AAAAAAAAGCTGTAGAACTTTGG - Intronic
959690104 3:109189386-109189408 AAAGGACAGCTGGAGAACTTGGG - Intergenic
960711021 3:120528146-120528168 AAGAGAAAGCTGGGAAAGCTAGG - Intergenic
961693783 3:128689756-128689778 AAAAGAAAAATAGACAAACTGGG + Intergenic
961753596 3:129112948-129112970 AAAAGAAGCCTGGACAACATAGG - Intronic
963601441 3:147382201-147382223 AAAAGAAAGTTTGCCAGCCTTGG + Intergenic
963816302 3:149835080-149835102 TAAAGAAAGCTTCACAACATTGG + Intronic
965210989 3:165788621-165788643 AGAAGAAAACTGGACAATTTAGG - Intronic
966787112 3:183631825-183631847 TAAATAAAGCTGGACAGCCTGGG + Intergenic
967202674 3:187086760-187086782 AAAAGAAATCTTTATAACCTTGG - Intergenic
967998404 3:195184230-195184252 AAAAGAACAATGGACAAGCTTGG + Intronic
968235165 3:197027099-197027121 GAAAAAAAGCTAGAAAACCTAGG - Intronic
968709260 4:2101396-2101418 AAAAGAAAACTCCACAATCTAGG + Intronic
969126242 4:4950417-4950439 CATAGAAAGCTGGAGAAACTGGG - Intergenic
972393448 4:38635018-38635040 AAAAGAGAGCTGGATAAGTTGGG + Intergenic
973812590 4:54586241-54586263 ACAAGAAAGCTGATCAACATGGG + Intergenic
974293292 4:59962276-59962298 AAAAGAAATCAAGTCAACCTGGG + Intergenic
975096390 4:70461909-70461931 AAAAGAAAGGTTGACAAGCTGGG + Intronic
975878638 4:78874733-78874755 AAAAGAAAGTTGGATATCCAAGG + Intronic
976085292 4:81401619-81401641 AAAAGAAAGCTGCAAAACCCTGG - Intergenic
978836940 4:113162199-113162221 AAAAAAAAGCTGTAAAACTTGGG - Intronic
980124255 4:128758497-128758519 ATAAGAAAGCTGCACATCCAGGG - Intergenic
980563520 4:134507703-134507725 AAAAGAAAGCTGGAAATATTTGG - Intergenic
980703199 4:136458260-136458282 AAAAGAGAGCTGGACCCCTTTGG + Intergenic
980932301 4:139193516-139193538 AAAAAAAAGTTGCATAACCTTGG + Intergenic
981961216 4:150541348-150541370 CAAGGAAAGCTGGAAAAACTGGG + Intronic
982163818 4:152596613-152596635 AAGAGGAAGCTGGACAGCATGGG - Intergenic
982371845 4:154642300-154642322 AAAAGAAAGATGAAGAAACTTGG + Intronic
982449774 4:155540023-155540045 AATAGAAAGTTGGACAGCCCTGG - Intergenic
982770822 4:159395746-159395768 AAGACAAGGCTGGACAACATAGG - Intergenic
983354357 4:166637036-166637058 AAAAGAAATCTGGAGAACTCTGG - Intergenic
984247244 4:177289673-177289695 GAAAGAAAGCTGGATTTCCTAGG - Intergenic
984468804 4:180138205-180138227 AAAAGTAATATGGACAATCTAGG - Intergenic
984807092 4:183761578-183761600 AAAAGAAAGTTGGCCAAACCAGG + Intergenic
985329241 4:188809472-188809494 TAAAGAAAGCTTGCCTACCTTGG - Intergenic
986661398 5:10063385-10063407 AAAATAAAGCTGGGCCAGCTGGG + Intergenic
987739353 5:21885315-21885337 AAACTAAAGTTGTACAACCTTGG - Intronic
988464508 5:31475564-31475586 AAAGGAAACCTAGAGAACCTTGG + Intronic
989471376 5:41822761-41822783 AAAAGAAAGCTGGAGCAATTAGG - Intronic
989999865 5:50880234-50880256 AAAAGAAAGCAGGAAAAGCTGGG + Intergenic
990090407 5:52039479-52039501 AAAAAAAAGCTGGATAATTTAGG - Intronic
990577036 5:57133273-57133295 CAAACAAACCTGGGCAACCTAGG - Intergenic
990597087 5:57322870-57322892 AAAAAAAAGGTGGCCACCCTGGG - Intergenic
991184518 5:63791926-63791948 AAAAGAAATATTGACAACCATGG + Intergenic
992142897 5:73817297-73817319 ACCAGAAAGCTTGACAACCTTGG + Intronic
992453478 5:76894348-76894370 AAAACCAAGCTGCACCACCTTGG + Intronic
992809446 5:80371979-80372001 GATAAATAGCTGGACAACCTCGG + Intergenic
993334196 5:86636648-86636670 GAAAAAAAACTGGACAACTTTGG + Intergenic
993578218 5:89627754-89627776 AACACAAAACTAGACAACCTTGG + Intergenic
994557709 5:101325117-101325139 AAAACAAAGCTGTAACACCTTGG + Intergenic
994738133 5:103583139-103583161 AAAAGGAAACTGGACAAGCAAGG + Intergenic
995350709 5:111172232-111172254 AAAAGATGGTTGGATAACCTAGG - Intergenic
995424820 5:112008782-112008804 AAAAAAAAGCTGGGCTACTTGGG - Intergenic
996075783 5:119192062-119192084 AAAAAAAGGTTGGAAAACCTTGG - Intronic
996160088 5:120150981-120151003 GAAAGAGATCTGGCCAACCTGGG + Intergenic
997174253 5:131757643-131757665 AAAAAAAAGGTGGACAAATTGGG + Intronic
998882620 5:146658673-146658695 AAAAGGAAGAAGGAGAACCTAGG - Intronic
999664362 5:153897290-153897312 AAAAGAAAGTTGGACACCAAAGG - Intergenic
999800696 5:155031085-155031107 AAAAGAAAACTCAACAAACTAGG - Intergenic
1001915402 5:175556203-175556225 AAAAGAAAGCTGGATAGGCCAGG + Intergenic
1002134605 5:177099863-177099885 AAAAGAAAGTTGGTCAGTCTGGG - Intergenic
1002621863 5:180494024-180494046 AAAAAAAAAGTGGACAACCTGGG + Intergenic
1004267680 6:14163333-14163355 AAAAGCAAGATGGAAAATCTTGG + Intergenic
1004508986 6:16269376-16269398 AAAGGAAAGCTGGAAAAATTGGG + Intronic
1004614796 6:17280486-17280508 AAACCCAAGCTGGACACCCTGGG - Intergenic
1005530275 6:26697696-26697718 AAAAGAAAGATCGTCATCCTGGG + Intergenic
1005540521 6:26803950-26803972 AAAAGAAAGATCGTCATCCTGGG - Intergenic
1006088930 6:31616358-31616380 AAACGAATGCTGGAGAAACTTGG + Exonic
1006720456 6:36146746-36146768 AAAAGAAAGATTGCCAGCCTGGG - Intergenic
1007150206 6:39683029-39683051 AAAAGAAAGCTGCTGAGCCTGGG + Intronic
1007475871 6:42119640-42119662 AAAAACAAGCTGGACAGGCTGGG - Intronic
1008621057 6:53271821-53271843 AAAATAAATCCTGACAACCTGGG + Intronic
1008682404 6:53886933-53886955 CAAAGAGAACTGGACAACCAAGG - Intronic
1009011336 6:57846047-57846069 AAAAGAAAGATCGTCATCCTGGG - Intergenic
1009867742 6:69418353-69418375 AGAAGAAAGCTGGGCAACTGAGG - Intergenic
1009937161 6:70247580-70247602 AAAAGAATGCTGATTAACCTAGG + Intronic
1010240440 6:73610695-73610717 AAAAAAATGCTGGAAAACATGGG + Intronic
1011383179 6:86765123-86765145 GAAAGAAAGCGGTACAACCCAGG - Intergenic
1011641081 6:89416880-89416902 AAAAGAAACCTGTACAATGTAGG + Intergenic
1012919400 6:105205873-105205895 AAAGGAAAGCTGAAGAACCAGGG - Intergenic
1012948023 6:105488568-105488590 AAAAGAAAGCTGGAAACTGTGGG + Intergenic
1013046322 6:106489075-106489097 AAAAGTAAGCTGCAGACCCTTGG - Intergenic
1013982679 6:116150784-116150806 GTAAGGAAGCTGGAGAACCTTGG + Intronic
1017775009 6:157673620-157673642 AAAAGAAAGCAGCACTTCCTTGG - Exonic
1017960450 6:159216748-159216770 AGAAGCAAGCTGGAGAACATAGG - Intronic
1021480300 7:21107911-21107933 AAAAAAAAGGTGGACAGGCTGGG - Intergenic
1023994530 7:45151219-45151241 AAAAGGAAGATGGAAAACCCAGG - Intergenic
1024041500 7:45559533-45559555 AAAAGCAAGCTGGAAAACAATGG - Intergenic
1027604077 7:80277901-80277923 ATAAGAAAGATGGACAAGTTTGG + Intergenic
1028702375 7:93795008-93795030 AAAAAAAATCTAGATAACCTTGG - Intronic
1029413344 7:100428963-100428985 AAGAGGAAGTTGGACAACATCGG + Intronic
1029568286 7:101354190-101354212 AAATGGAAGCTGGACAAACATGG - Intergenic
1030474993 7:110020525-110020547 TAAAGAAAGCTAAACAACCATGG - Intergenic
1030496115 7:110303001-110303023 AAAAGAAGGCTAGATAAGCTGGG - Intergenic
1030993995 7:116335734-116335756 AAAAGGAAGCTACACAGCCTAGG + Intronic
1032383790 7:131507636-131507658 AAAAGGAAGATGGAAAACCCTGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032945528 7:136847797-136847819 GAAAGGAAGCTGGAAAACCTTGG + Intergenic
1033983339 7:147193018-147193040 TAGTGATAGCTGGACAACCTGGG + Intronic
1035524519 8:301816-301838 AAAGGAAGGCTGGAGTACCTGGG - Intergenic
1036925678 8:12902796-12902818 AGAAGAAAACTTGAGAACCTTGG - Intergenic
1037321068 8:17643544-17643566 ATAAGAAAATTGGACAAACTTGG - Intronic
1037357045 8:18031563-18031585 TAAAGAAAGTTGGACAGGCTTGG - Intergenic
1039022024 8:33218446-33218468 AAAAGAAGGCAGGAGAACCCTGG - Intergenic
1039643253 8:39247764-39247786 AAAAAAAACCTGGATGACCTTGG - Intronic
1039718571 8:40137512-40137534 AAAAGGAAGCTGGAGGACCAAGG - Intergenic
1042576168 8:70221546-70221568 AAAAGAAAGTAGGCCAAACTTGG + Intronic
1043062829 8:75526751-75526773 AAAAGAATGCTTGTTAACCTGGG - Intronic
1044305113 8:90630702-90630724 AAAAAAAATCTGTACATCCTAGG + Intronic
1044653480 8:94523621-94523643 AAAAGAAATTTGGCCAGCCTGGG - Intronic
1044702706 8:94978725-94978747 AAAAAAAAGCTGGCAAACATAGG + Intronic
1045517100 8:102869427-102869449 AAAAGAAAACTGTACTACATTGG + Intronic
1045708111 8:104950822-104950844 AAAATAAAGATGGCCAACCCTGG - Intronic
1047018056 8:120744896-120744918 AAAAGAAAGCTGTGGAACTTGGG - Intronic
1048307268 8:133293064-133293086 AAAAGAAACCTGGGCTCCCTCGG - Intronic
1054871140 9:70048112-70048134 TCAAGAAAGCAGGACAACCATGG - Intronic
1054992073 9:71340050-71340072 AAAAGAAATCTACACAACATTGG + Intronic
1056086483 9:83154653-83154675 GAAAGAGAGATGGCCAACCTAGG - Intergenic
1057094223 9:92290736-92290758 AAAAGTAAGCAGGAAAATCTTGG + Intronic
1057305089 9:93907646-93907668 GAAAGAAAGCTGGACACATTGGG - Intergenic
1059054333 9:110962993-110963015 GAAAGACAGCTGGAGAATCTAGG + Intronic
1059612393 9:115912805-115912827 TAATGAGAGCTGGACAAACTGGG + Intergenic
1060375166 9:123110614-123110636 AAATGAAAGCTGGTCCACGTGGG - Intronic
1061585435 9:131564575-131564597 AAAACAAGGCTGGGCAACATAGG - Intergenic
1062689903 9:137836214-137836236 AAAAGGAAGCTGTACTTCCTTGG - Intronic
1203423197 Un_GL000195v1:14107-14129 AAAGGAGAGCTGCATAACCTGGG + Intergenic
1185698752 X:2214549-2214571 AAAAGAAAGCAAAACAACTTGGG + Intergenic
1186252627 X:7684990-7685012 GAAAGAGAGGTGGTCAACCTTGG - Intergenic
1186328581 X:8507726-8507748 AAAAGAAAGCTGTATTGCCTCGG + Intergenic
1187706795 X:22017261-22017283 AAAACAAAACCGAACAACCTTGG + Intergenic
1188259295 X:28003572-28003594 AAAGGGAAGCTGGACAAACAAGG + Intergenic
1190162869 X:48046548-48046570 GAAAGGAAGCTGGACAAGCAAGG + Intronic
1190310740 X:49115527-49115549 AAAAGAAAACTTGACAGACTGGG + Intronic
1190925527 X:54900197-54900219 AAAAGATAACTGGACAACCAAGG + Intergenic
1191054597 X:56229047-56229069 AAAAGAAGGCTTGAGAAGCTGGG - Intergenic
1196688367 X:118532120-118532142 AAAAAAAAGCTGAACACCCAAGG + Intronic
1197381206 X:125743006-125743028 AACAAAACACTGGACAACCTTGG - Intergenic