ID: 1181178186

View in Genome Browser
Species Human (GRCh38)
Location 22:21049518-21049540
Sequence CCCAGCCACCTCTTTAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 2, 2: 2, 3: 23, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181178186_1181178194 21 Left 1181178186 22:21049518-21049540 CCTACTTTAAAGAGGTGGCTGGG 0: 1
1: 2
2: 2
3: 23
4: 171
Right 1181178194 22:21049562-21049584 TTAAGCTGAAATGTGCAGGGTGG 0: 2
1: 0
2: 0
3: 22
4: 203
1181178186_1181178193 18 Left 1181178186 22:21049518-21049540 CCTACTTTAAAGAGGTGGCTGGG 0: 1
1: 2
2: 2
3: 23
4: 171
Right 1181178193 22:21049559-21049581 CATTTAAGCTGAAATGTGCAGGG 0: 2
1: 0
2: 4
3: 37
4: 275
1181178186_1181178195 22 Left 1181178186 22:21049518-21049540 CCTACTTTAAAGAGGTGGCTGGG 0: 1
1: 2
2: 2
3: 23
4: 171
Right 1181178195 22:21049563-21049585 TAAGCTGAAATGTGCAGGGTGGG 0: 2
1: 0
2: 1
3: 21
4: 249
1181178186_1181178196 26 Left 1181178186 22:21049518-21049540 CCTACTTTAAAGAGGTGGCTGGG 0: 1
1: 2
2: 2
3: 23
4: 171
Right 1181178196 22:21049567-21049589 CTGAAATGTGCAGGGTGGGAAGG 0: 2
1: 0
2: 2
3: 54
4: 450
1181178186_1181178192 17 Left 1181178186 22:21049518-21049540 CCTACTTTAAAGAGGTGGCTGGG 0: 1
1: 2
2: 2
3: 23
4: 171
Right 1181178192 22:21049558-21049580 ACATTTAAGCTGAAATGTGCAGG 0: 2
1: 0
2: 1
3: 52
4: 338
1181178186_1181178190 -8 Left 1181178186 22:21049518-21049540 CCTACTTTAAAGAGGTGGCTGGG 0: 1
1: 2
2: 2
3: 23
4: 171
Right 1181178190 22:21049533-21049555 TGGCTGGGGAGGCCTCTGTGAGG 0: 2
1: 0
2: 5
3: 83
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181178186 Original CRISPR CCCAGCCACCTCTTTAAAGT AGG (reversed) Intronic
902605302 1:17565821-17565843 TACAGCCGCCTCTTTAAGGTGGG - Intronic
906134364 1:43485874-43485896 CCCAGCCCCCATTTTAAAATTGG + Intergenic
906948344 1:50314793-50314815 CCTTGCCTCCTCTTTAAAGGGGG + Intergenic
908645243 1:66271384-66271406 CCCACCCTCCCCTTGAAAGTTGG + Intronic
915088493 1:153405134-153405156 CCCAGCCTCGTCTTAAAATTGGG + Intergenic
915096401 1:153465698-153465720 CCCAGCCTCCTCTTGAAATTGGG - Intergenic
915749758 1:158195622-158195644 GTCAGCCACCTCAGTAAAGTTGG - Intergenic
917078006 1:171226112-171226134 ATCAGGCACCTCTTTAAAGGAGG - Intergenic
920174237 1:204090108-204090130 CCCAGCCACATCTTCAAGCTGGG + Intronic
921315136 1:213883228-213883250 CCCAGCTTCCTCTTTAAGGGTGG + Intergenic
921726815 1:218533338-218533360 ACCAGCCACATTTCTAAAGTGGG - Intergenic
922114890 1:222603292-222603314 CCCAGCCAGCTTTTTAAATTTGG + Intergenic
923179523 1:231502801-231502823 CCCAGCCTCCACCTTCAAGTAGG + Intergenic
923915000 1:238492114-238492136 CCCAGCCAGCTATTTATATTGGG - Intergenic
1062956449 10:1543271-1543293 CACAGGCAACTCTTTGAAGTTGG - Intronic
1063517296 10:6709559-6709581 CCCACTCACCTCTTAAAAGAAGG - Intergenic
1067537006 10:47118554-47118576 CCCAGCCAACGCCTTGAAGTAGG + Intergenic
1068326042 10:55488150-55488172 CCCACCCACCATTTTAAAATTGG + Intronic
1068546531 10:58352662-58352684 CCTATCCATCTCTTTAAACTTGG - Intronic
1071516544 10:86301481-86301503 CTCTGCCAGCTCTTTAAAGGGGG + Intronic
1072275162 10:93815810-93815832 CCCACCCACCTCACTGAAGTAGG + Intergenic
1073459037 10:103655029-103655051 TCCAGCCAGCTCTGTGAAGTGGG + Intronic
1073627712 10:105116877-105116899 CCCACCCTCCACTTTTAAGTAGG - Intronic
1074185107 10:111094370-111094392 CCCAGCAACCTCTTTTCACTGGG + Intergenic
1074445738 10:113519826-113519848 CTCAGCCACCTCTTCACAGAAGG - Intergenic
1074853910 10:117459411-117459433 CCCAGCCAGCTCTTTGAACTTGG - Intergenic
1075027994 10:119001063-119001085 CCCAGCCAAGTTTCTAAAGTTGG + Intergenic
1075243046 10:120795009-120795031 ACCAGTCACCTCTTTGAATTAGG + Intergenic
1075327213 10:121543564-121543586 CCCAGGCACCTGCTGAAAGTGGG - Intronic
1075364908 10:121877579-121877601 CCCCCCTACCTTTTTAAAGTTGG - Intronic
1078240367 11:9525774-9525796 CACAGCCCCCATTTTAAAGTGGG + Intronic
1078568623 11:12438708-12438730 CCTAAACACCTCCTTAAAGTAGG + Intronic
1084126484 11:67102436-67102458 CACAGCCAGCTCTTGAAAGAGGG + Intergenic
1084772472 11:71352729-71352751 CCCAGCCACCTCTCCTAAGATGG + Intergenic
1089756770 11:120693030-120693052 CCCAGACAACTCTTAAAAGAGGG + Intronic
1090709288 11:129371712-129371734 TCCAGCCACTTCATTAATGTTGG + Intergenic
1095817656 12:46442060-46442082 CCCAGTAATCTCTTTTAAGTAGG + Intergenic
1096799113 12:54097763-54097785 CCCAGGCACCTCTCTCAATTTGG - Intergenic
1102999985 12:117377870-117377892 CCCAGCCACAACTATAAACTAGG - Intronic
1105006389 12:132723487-132723509 CCCCGGCTCCTCTGTAAAGTGGG + Intergenic
1107171372 13:37346049-37346071 CCCATCCAACTCTTTGATGTGGG + Intergenic
1107603665 13:42039068-42039090 CTCAGCCACCTCTTGCATGTTGG - Intergenic
1107682644 13:42867317-42867339 TCCAGCTACCTCTTCAAAGGAGG + Intergenic
1108381556 13:49859746-49859768 CCCAGCCTCCTCTTTAATCAAGG - Intergenic
1109155099 13:58900050-58900072 CCCACCCACATTTGTAAAGTAGG + Intergenic
1110123626 13:71913696-71913718 ATCAGCCACCTCAGTAAAGTTGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113612686 13:111658671-111658693 CCAAGCCACGGCTTTACAGTTGG + Intronic
1115005100 14:28472896-28472918 CCCAGCCTCCACTCTCAAGTAGG + Intergenic
1116076640 14:40119433-40119455 TCCAGCCACCTCTGTCAAGGTGG - Intergenic
1117527134 14:56620130-56620152 CCCAGCCTCCACTCTCAAGTAGG - Intronic
1117715793 14:58579613-58579635 CTCAGCAACTTCTTTAAGGTGGG + Intergenic
1119970418 14:78964062-78964084 TCCAGCCAATTCTTTAAATTAGG + Intronic
1121723980 14:96132647-96132669 CCCAGCCCCCTCACTGAAGTTGG - Intergenic
1122140200 14:99659097-99659119 CGCTGCCACATCTGTAAAGTGGG + Intronic
1122309428 14:100785180-100785202 CCCAGCCTCGTCTCTCAAGTGGG + Intergenic
1126040926 15:44590105-44590127 CCTAGCAACTTCTTTAAAGAGGG + Intronic
1126634010 15:50764803-50764825 CCCACCCATCCCTTTAAATTAGG + Intronic
1127948190 15:63776425-63776447 GCCAGCCACCTTTCCAAAGTGGG - Intronic
1129282577 15:74497527-74497549 CCCAGCCACCTCTTTAATCATGG + Intergenic
1129701966 15:77773421-77773443 ACCAGCCTCATCTGTAAAGTCGG - Intronic
1129890428 15:79068144-79068166 CTCAGCCCCCTCTGTGAAGTGGG - Intronic
1131275085 15:90974060-90974082 CCCAGCCACCTCTTTGAAGGGGG - Intronic
1133135740 16:3710286-3710308 CCCAGCCACATCTGCAAACTAGG + Intronic
1133898013 16:9947816-9947838 CACAACAACCTCTTTAAGGTAGG - Intronic
1133901174 16:9976505-9976527 CCAAGCCTCCTCTTTAAAGTTGG + Intronic
1137538470 16:49345300-49345322 ATCAGCCACCTCATTAAACTGGG + Intergenic
1141190270 16:81819530-81819552 CCCAGCCACCTCTGGAAGGCTGG + Intronic
1142038692 16:87878582-87878604 CCCTGCCACCACCTTGAAGTTGG + Intergenic
1142795320 17:2303223-2303245 CCCGGCCACCGCTTTAACGTCGG - Intronic
1144767464 17:17740388-17740410 CACAGCCACCTCTGGAGAGTTGG + Intronic
1144913025 17:18698629-18698651 CACAACCACCACTTAAAAGTAGG - Exonic
1147987026 17:44312677-44312699 CTCAGCCACCGCTTCAAAGGTGG + Exonic
1148328190 17:46796195-46796217 CCCCGCAGCCTCTTTGAAGTGGG - Intronic
1152455571 17:80414325-80414347 CCCAACCACCGGTTTAAAGTCGG + Intergenic
1152720087 17:81919235-81919257 CCCATCCACATCTGGAAAGTCGG - Exonic
1153000494 18:451113-451135 TCCATACACCTCTTTCAAGTAGG + Intronic
1153950183 18:10051867-10051889 CCCGGCCACCTCTTCATACTTGG + Intergenic
1157450898 18:47788099-47788121 TCCAGCCACCTCTTTGATTTCGG + Intergenic
1158121530 18:54053779-54053801 CCCAGACATCTGTTTCAAGTGGG - Intergenic
1158737338 18:60098201-60098223 GCCTGCCACATCTTAAAAGTGGG + Intergenic
1159079842 18:63724604-63724626 TCCAGCCACCTCTTCTAAGATGG - Intronic
1160444719 18:78918377-78918399 CCAAGCCTTCTCTGTAAAGTGGG + Intergenic
1161393122 19:4031571-4031593 CCCAGCCTCCTCCCTCAAGTTGG - Intronic
1161499738 19:4607276-4607298 CACAGCCTCCTCATTAAAGCAGG - Intergenic
1162341760 19:10095496-10095518 CCCAGCCTCCTCTGTAGAGTAGG + Intronic
1164605612 19:29595882-29595904 TCCTGCCACTTCTATAAAGTGGG - Intergenic
1166744480 19:45134296-45134318 CCCAGTCTCCTCTCTAAAGTGGG + Intronic
1167262618 19:48467596-48467618 CCCAGGCACCCCTGTAAAGAGGG - Intronic
1167522744 19:49965686-49965708 CCCAGCCACCTCTGTCAAGGCGG - Intergenic
1168183536 19:54681211-54681233 CCCAGGCACATCTTTAACTTTGG + Intronic
925017354 2:541389-541411 CCCACCCTCCTCCTTCAAGTAGG - Intergenic
926235497 2:11040127-11040149 CTCAGCCACTACTTTAAACTGGG + Intergenic
927141114 2:20131374-20131396 CCCAGCCACTTCCTGAGAGTAGG - Intergenic
927143987 2:20148986-20149008 CCAAGCCAGCACTTTAAAGTCGG - Intergenic
930918899 2:56726852-56726874 CCCAGCCACCACTCTCAAGTAGG + Intergenic
931578703 2:63749613-63749635 CCCAACTACCTGTTTAAGGTAGG + Intronic
935251187 2:101262674-101262696 CAAAGCCACCTATTGAAAGTAGG + Exonic
935718963 2:105962652-105962674 TGCAGCCACCTCTTTAAAGATGG + Intergenic
936238700 2:110768700-110768722 CCCACCCTCCTCTCTCAAGTAGG + Intronic
936817140 2:116473345-116473367 CCCCTCCATCACTTTAAAGTGGG + Intergenic
936890166 2:117360068-117360090 CCCTGCCACCCCATTAAAGTTGG + Intergenic
937571689 2:123370881-123370903 CCCATCCACCACTCTCAAGTAGG - Intergenic
941597913 2:167501189-167501211 TCCAGAAAACTCTTTAAAGTGGG + Intergenic
945063567 2:205929124-205929146 GCCAGCCACCTCTTGAATGAGGG - Intergenic
946831686 2:223734285-223734307 CCCAGCCTCCTCTTTAAAGTAGG + Intergenic
947761475 2:232606578-232606600 CCGACCCTCATCTTTAAAGTTGG + Intronic
1168966864 20:1904048-1904070 CCAAGCCTCCTCTTTAAAAGGGG - Intronic
1170558141 20:17531690-17531712 CCAAGCGAACTCTTTAAACTTGG + Intronic
1170870832 20:20204618-20204640 CCCAGCCCCTTCCTTAAACTTGG + Intronic
1172024140 20:31936573-31936595 CACAGCCACCCCTTTAGACTTGG + Intronic
1172110647 20:32542889-32542911 CACTGGCTCCTCTTTAAAGTGGG + Intronic
1172788291 20:37484958-37484980 CCCAACCACCCATCTAAAGTGGG - Intergenic
1172808798 20:37632571-37632593 CACAGCCTCCCCTTTGAAGTGGG + Intergenic
1173620754 20:44434204-44434226 CCGAGCCTCATCTGTAAAGTGGG + Intergenic
1173822715 20:46029479-46029501 CCCAGCCTCCTCTCTGAAGGAGG - Intronic
1173919121 20:46730830-46730852 CCCAGTTACCTCTTAAAAGCAGG + Intronic
1178949113 21:36971531-36971553 CCCAGCCGGCTCTTGAAAATTGG - Intronic
1179051009 21:37888641-37888663 CCCAGCCATCTCCGTGAAGTTGG + Intronic
1180132074 21:45833350-45833372 CCCAGGCATCTCTGTAAAGAAGG + Intronic
1181171158 22:21011001-21011023 CCCAGCCACCTCTTTAAAGCAGG + Intronic
1181178186 22:21049518-21049540 CCCAGCCACCTCTTTAAAGTAGG - Intronic
1181336911 22:22142699-22142721 CCCAGCCATGTCTTTAACCTTGG + Intergenic
1184363587 22:44033951-44033973 TCCATCCACATGTTTAAAGTGGG - Intronic
949170609 3:991747-991769 CACAACCACCTTTTTAAAGTAGG - Intergenic
950015366 3:9751160-9751182 CTGAGCCACCTCTTGGAAGTGGG - Exonic
952256916 3:31703764-31703786 CCCAACCATCTCTTTAGAATTGG - Intronic
954222219 3:49161794-49161816 CCCAGCCCCCTCTCTAAAGCAGG + Intergenic
955997084 3:64688269-64688291 CCCCGCCACCTCGCTGAAGTGGG + Intergenic
956803276 3:72783177-72783199 CCCAGCCACAGCTATAAAATGGG + Intronic
957866630 3:86033460-86033482 CCCAGCATCCTCTGTACAGTAGG + Intronic
959737184 3:109672951-109672973 CCCAGCCATCTCTGGATAGTTGG - Intergenic
961326630 3:126112950-126112972 CCCAGCCGCCTCTTCTAATTAGG + Intronic
961578311 3:127856705-127856727 CCCAGCCTCCACCTTCAAGTAGG + Intergenic
962319886 3:134381723-134381745 ACCAGACACCTCTATGAAGTGGG - Intergenic
962832351 3:139155544-139155566 CCCACCCACCACCTTCAAGTAGG - Intronic
964143592 3:153432080-153432102 CCCAGACACATCTGTAAAGTAGG - Intergenic
965036718 3:163449339-163449361 CCCACCCTCCACTTTCAAGTAGG - Intergenic
965406722 3:168278080-168278102 GACAGCTACATCTTTAAAGTTGG + Intergenic
966624169 3:181998838-181998860 TCCTGCCGCCTCTTTGAAGTTGG + Intergenic
970183598 4:13425523-13425545 CCCAGCCACAACTTTAATGTAGG - Intronic
971940044 4:33202236-33202258 CTCTGCCAGCTCTTTAAAGTGGG - Intergenic
975310904 4:72902836-72902858 GCCAGCCACGTCTTTGAAATTGG - Intergenic
980421331 4:132565277-132565299 CCCAGACACCTCTGTTAAGGTGG - Intergenic
981138135 4:141236405-141236427 CCCAGCCACCTCTTCAGTCTGGG - Intergenic
983548205 4:168985899-168985921 CCCACCCTCCACTTTCAAGTAGG - Intronic
986549956 5:8941581-8941603 CCTAACCACCTCCTTCAAGTAGG - Intergenic
987072273 5:14349875-14349897 CCCAGCCTCCACCTTCAAGTAGG + Intronic
991043597 5:62200062-62200084 CTCACGCACTTCTTTAAAGTGGG - Intergenic
992466517 5:77011679-77011701 CCCACCCACCTCTTTATATCAGG + Intergenic
994307695 5:98227046-98227068 TCCAAGCACCTCTTTAAACTGGG - Intergenic
994699749 5:103119609-103119631 CCCCGCCACGTATTTAAATTTGG + Intronic
994731729 5:103499525-103499547 CCCACCCCCCTCTTTATAGATGG - Intergenic
996142340 5:119927800-119927822 CCCACCCTCCACTTTCAAGTAGG + Intergenic
1001297440 5:170508152-170508174 CCCAGCCACCCCTGTAGTGTGGG - Intronic
1001527532 5:172439436-172439458 CTCAGCCAACCCTATAAAGTAGG - Intronic
1003586997 6:7399903-7399925 CCCAGCCACTTCATTGAAGGTGG + Intronic
1003888144 6:10539487-10539509 CCCCGCCATCTCTTTAACTTTGG + Intronic
1004132952 6:12938367-12938389 CCCAGCCACCTCTCTATGTTAGG + Intronic
1005189728 6:23206945-23206967 TCCAGTCACCTCTTTCATGTAGG - Intergenic
1006893293 6:37448248-37448270 GGCAGCCACTTCTTTACAGTAGG + Intronic
1007367901 6:41407488-41407510 CCAGGCCACCTCTCGAAAGTGGG + Intergenic
1009325712 6:62345808-62345830 ACCAGCCTGCTTTTTAAAGTGGG + Intergenic
1010590834 6:77710074-77710096 GCAAGGCACTTCTTTAAAGTGGG - Intronic
1017044030 6:150330580-150330602 CGCAGGCACCACTTGAAAGTGGG - Intergenic
1020266576 7:6564543-6564565 CCCAGACACCCGTTTAAAATTGG + Intergenic
1020688127 7:11320775-11320797 CCCATCCACATTTTTACAGTTGG - Intergenic
1023176755 7:37442995-37443017 CCAAGCCACATCTGTAAAATGGG + Intronic
1023711926 7:43003940-43003962 CTCAGCCACCTCTTTTGGGTTGG + Intergenic
1024237633 7:47409955-47409977 CCCGGCCTCCTCTTTAAAGCTGG + Intronic
1028053205 7:86209255-86209277 CCCACCCACCCCTTCCAAGTTGG - Intergenic
1029248124 7:99217361-99217383 ACCAGCCAGTTCTTCAAAGTAGG + Intergenic
1030004055 7:105097681-105097703 CCCAGCCACCTATTTTTATTAGG + Intronic
1031059260 7:117031179-117031201 CCCACCCTCCTCCTTCAAGTAGG - Intronic
1033367093 7:140679972-140679994 CCCAGCCTCCTCTTTACAGATGG + Intronic
1034173724 7:149083688-149083710 CCCAGCCTCCACCTTCAAGTAGG + Intronic
1037200233 8:16243245-16243267 CCCAGCAGTCTCTTTAAAGCAGG + Intronic
1038813125 8:30871986-30872008 CCCAGCTACTTCTTTACAGAAGG - Intronic
1039629220 8:39090600-39090622 CCAAGCCACCTCTTTTAATGGGG + Intronic
1042828565 8:73002965-73002987 ACCAAACACCTCTTTAAAGTAGG + Intergenic
1047617844 8:126577744-126577766 CCAAGACACCTCTTTAATGTGGG - Intergenic
1048474254 8:134729254-134729276 CCCAGGCTCCTCTGTAAAATTGG + Intergenic
1051237191 9:15013964-15013986 CTCACCCAACTCTTTAAAGTAGG + Intergenic
1055231363 9:74070518-74070540 CCCACCCTCCTCTCTCAAGTGGG + Intergenic
1056335742 9:85566848-85566870 CTCAGCCTCCTTTCTAAAGTGGG - Intronic
1061629219 9:131861043-131861065 CACAGCCACCTCTTAGTAGTGGG - Intronic
1185593696 X:1294644-1294666 CCCTGCAACCTCTTTCAAGGTGG - Intronic
1187920161 X:24194033-24194055 CCTAGCTACCTCTTATAAGTGGG + Intronic
1189432945 X:40965357-40965379 CCCAGACACCTCTATAAACAAGG + Intergenic
1191206436 X:57838728-57838750 CCCACCCTCCACTTTCAAGTAGG + Intergenic
1191600456 X:62999818-62999840 CCCACCCTTCTCTTTCAAGTAGG + Intergenic
1195591320 X:106630748-106630770 CCCACCCTCCACTTTCAAGTAGG - Intronic
1196036152 X:111147509-111147531 CCCACCCACCCTTTTTAAGTTGG + Intronic
1196487756 X:116233308-116233330 CCCAGCCTCCACTCTCAAGTAGG + Intergenic
1196579941 X:117367070-117367092 CCCATCCTCCACTTTCAAGTAGG + Intergenic
1197371307 X:125628860-125628882 CCCAGCCACCTCTGTCACGGTGG + Intergenic
1197800068 X:130339408-130339430 CCCAGGCACCTCACTAAATTCGG + Intergenic
1200341053 X:155395993-155396015 CCCACCCTCCACTTTCAAGTGGG - Intergenic
1200714525 Y:6522233-6522255 CCTAGCCACTCCTTTAAAATGGG + Intergenic