ID: 1181181475

View in Genome Browser
Species Human (GRCh38)
Location 22:21071445-21071467
Sequence GTCCATACTTGGCCTGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181181470_1181181475 4 Left 1181181470 22:21071418-21071440 CCATTTAGGGAAGGGTAAGGGTG No data
Right 1181181475 22:21071445-21071467 GTCCATACTTGGCCTGGACAAGG No data
1181181459_1181181475 27 Left 1181181459 22:21071395-21071417 CCCAGAAGCCCTTGGCCACGGGT No data
Right 1181181475 22:21071445-21071467 GTCCATACTTGGCCTGGACAAGG No data
1181181462_1181181475 18 Left 1181181462 22:21071404-21071426 CCTTGGCCACGGGTCCATTTAGG No data
Right 1181181475 22:21071445-21071467 GTCCATACTTGGCCTGGACAAGG No data
1181181457_1181181475 28 Left 1181181457 22:21071394-21071416 CCCCAGAAGCCCTTGGCCACGGG No data
Right 1181181475 22:21071445-21071467 GTCCATACTTGGCCTGGACAAGG No data
1181181466_1181181475 12 Left 1181181466 22:21071410-21071432 CCACGGGTCCATTTAGGGAAGGG No data
Right 1181181475 22:21071445-21071467 GTCCATACTTGGCCTGGACAAGG No data
1181181460_1181181475 26 Left 1181181460 22:21071396-21071418 CCAGAAGCCCTTGGCCACGGGTC No data
Right 1181181475 22:21071445-21071467 GTCCATACTTGGCCTGGACAAGG No data
1181181461_1181181475 19 Left 1181181461 22:21071403-21071425 CCCTTGGCCACGGGTCCATTTAG No data
Right 1181181475 22:21071445-21071467 GTCCATACTTGGCCTGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181181475 Original CRISPR GTCCATACTTGGCCTGGACA AGG Intergenic
No off target data available for this crispr