ID: 1181181666

View in Genome Browser
Species Human (GRCh38)
Location 22:21072924-21072946
Sequence GGCTCTCCTTTGCTCTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181181660_1181181666 -1 Left 1181181660 22:21072902-21072924 CCATGTGGAGTACCTTGGCCAGG No data
Right 1181181666 22:21072924-21072946 GGCTCTCCTTTGCTCTGGCCTGG No data
1181181657_1181181666 2 Left 1181181657 22:21072899-21072921 CCCCCATGTGGAGTACCTTGGCC No data
Right 1181181666 22:21072924-21072946 GGCTCTCCTTTGCTCTGGCCTGG No data
1181181659_1181181666 0 Left 1181181659 22:21072901-21072923 CCCATGTGGAGTACCTTGGCCAG No data
Right 1181181666 22:21072924-21072946 GGCTCTCCTTTGCTCTGGCCTGG No data
1181181658_1181181666 1 Left 1181181658 22:21072900-21072922 CCCCATGTGGAGTACCTTGGCCA No data
Right 1181181666 22:21072924-21072946 GGCTCTCCTTTGCTCTGGCCTGG No data
1181181653_1181181666 17 Left 1181181653 22:21072884-21072906 CCATGGGGTCACAGCCCCCCATG 0: 2
1: 2
2: 1
3: 19
4: 291
Right 1181181666 22:21072924-21072946 GGCTCTCCTTTGCTCTGGCCTGG No data
1181181656_1181181666 3 Left 1181181656 22:21072898-21072920 CCCCCCATGTGGAGTACCTTGGC No data
Right 1181181666 22:21072924-21072946 GGCTCTCCTTTGCTCTGGCCTGG No data
1181181652_1181181666 18 Left 1181181652 22:21072883-21072905 CCCATGGGGTCACAGCCCCCCAT No data
Right 1181181666 22:21072924-21072946 GGCTCTCCTTTGCTCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181181666 Original CRISPR GGCTCTCCTTTGCTCTGGCC TGG Intergenic
No off target data available for this crispr