ID: 1181181786

View in Genome Browser
Species Human (GRCh38)
Location 22:21073633-21073655
Sequence GTGAAACGGAAATGTCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181181786_1181181791 26 Left 1181181786 22:21073633-21073655 CCATGAGGACATTTCCGTTTCAC No data
Right 1181181791 22:21073682-21073704 CTCCTGTGTCTGAGACGCCATGG No data
1181181786_1181181789 0 Left 1181181786 22:21073633-21073655 CCATGAGGACATTTCCGTTTCAC No data
Right 1181181789 22:21073656-21073678 CATTTGTCATCTTGAACAAGTGG No data
1181181786_1181181790 3 Left 1181181786 22:21073633-21073655 CCATGAGGACATTTCCGTTTCAC No data
Right 1181181790 22:21073659-21073681 TTGTCATCTTGAACAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181181786 Original CRISPR GTGAAACGGAAATGTCCTCA TGG (reversed) Intergenic
No off target data available for this crispr