ID: 1181181787

View in Genome Browser
Species Human (GRCh38)
Location 22:21073647-21073669
Sequence CAAGATGACAAATGGTGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181181787_1181181791 12 Left 1181181787 22:21073647-21073669 CCGTTTCACCATTTGTCATCTTG No data
Right 1181181791 22:21073682-21073704 CTCCTGTGTCTGAGACGCCATGG No data
1181181787_1181181793 19 Left 1181181787 22:21073647-21073669 CCGTTTCACCATTTGTCATCTTG No data
Right 1181181793 22:21073689-21073711 GTCTGAGACGCCATGGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181181787 Original CRISPR CAAGATGACAAATGGTGAAA CGG (reversed) Intergenic
No off target data available for this crispr