ID: 1181181795

View in Genome Browser
Species Human (GRCh38)
Location 22:21073701-21073723
Sequence ATGGATCTTGGCTACTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181181792_1181181795 -6 Left 1181181792 22:21073684-21073706 CCTGTGTCTGAGACGCCATGGAT No data
Right 1181181795 22:21073701-21073723 ATGGATCTTGGCTACTCCAGAGG No data
1181181788_1181181795 23 Left 1181181788 22:21073655-21073677 CCATTTGTCATCTTGAACAAGTG No data
Right 1181181795 22:21073701-21073723 ATGGATCTTGGCTACTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181181795 Original CRISPR ATGGATCTTGGCTACTCCAG AGG Intergenic
No off target data available for this crispr