ID: 1181182919

View in Genome Browser
Species Human (GRCh38)
Location 22:21079748-21079770
Sequence CTCCCTCGGCACTTTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181182908_1181182919 27 Left 1181182908 22:21079698-21079720 CCCAAGTGGGGTACAGGCAGGGG No data
Right 1181182919 22:21079748-21079770 CTCCCTCGGCACTTTCCTGGAGG No data
1181182910_1181182919 26 Left 1181182910 22:21079699-21079721 CCAAGTGGGGTACAGGCAGGGGG No data
Right 1181182919 22:21079748-21079770 CTCCCTCGGCACTTTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181182919 Original CRISPR CTCCCTCGGCACTTTCCTGG AGG Intergenic