ID: 1181191221 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:21142395-21142417 |
| Sequence | GAGAGCTCGTGGGGTGCGAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1181191221_1181191234 | 30 | Left | 1181191221 | 22:21142395-21142417 | CCCCTCGCACCCCACGAGCTCTC | No data | ||
| Right | 1181191234 | 22:21142448-21142470 | CCCCCACGCGCCGATTTCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1181191221 | Original CRISPR | GAGAGCTCGTGGGGTGCGAG GGG (reversed) | Intergenic | ||