ID: 1181191222

View in Genome Browser
Species Human (GRCh38)
Location 22:21142396-21142418
Sequence GGAGAGCTCGTGGGGTGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181191222_1181191234 29 Left 1181191222 22:21142396-21142418 CCCTCGCACCCCACGAGCTCTCC No data
Right 1181191234 22:21142448-21142470 CCCCCACGCGCCGATTTCCAAGG No data
1181191222_1181191236 30 Left 1181191222 22:21142396-21142418 CCCTCGCACCCCACGAGCTCTCC No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181191222 Original CRISPR GGAGAGCTCGTGGGGTGCGA GGG (reversed) Intergenic
No off target data available for this crispr