ID: 1181191223 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:21142397-21142419 |
Sequence | GGGAGAGCTCGTGGGGTGCG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1181191223_1181191236 | 29 | Left | 1181191223 | 22:21142397-21142419 | CCTCGCACCCCACGAGCTCTCCC | No data | ||
Right | 1181191236 | 22:21142449-21142471 | CCCCACGCGCCGATTTCCAAGGG | No data | ||||
1181191223_1181191234 | 28 | Left | 1181191223 | 22:21142397-21142419 | CCTCGCACCCCACGAGCTCTCCC | No data | ||
Right | 1181191234 | 22:21142448-21142470 | CCCCCACGCGCCGATTTCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1181191223 | Original CRISPR | GGGAGAGCTCGTGGGGTGCG AGG (reversed) | Intergenic | ||