ID: 1181191227

View in Genome Browser
Species Human (GRCh38)
Location 22:21142417-21142439
Sequence CGAGCTGAGCGCGAGAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181191227_1181191240 23 Left 1181191227 22:21142417-21142439 CCCGCCCTCTCGCGCTCAGCTCG No data
Right 1181191240 22:21142463-21142485 TTCCAAGGGCCCAGCACCTAAGG No data
1181191227_1181191243 25 Left 1181191227 22:21142417-21142439 CCCGCCCTCTCGCGCTCAGCTCG No data
Right 1181191243 22:21142465-21142487 CCAAGGGCCCAGCACCTAAGGGG No data
1181191227_1181191241 24 Left 1181191227 22:21142417-21142439 CCCGCCCTCTCGCGCTCAGCTCG No data
Right 1181191241 22:21142464-21142486 TCCAAGGGCCCAGCACCTAAGGG No data
1181191227_1181191234 8 Left 1181191227 22:21142417-21142439 CCCGCCCTCTCGCGCTCAGCTCG No data
Right 1181191234 22:21142448-21142470 CCCCCACGCGCCGATTTCCAAGG No data
1181191227_1181191236 9 Left 1181191227 22:21142417-21142439 CCCGCCCTCTCGCGCTCAGCTCG No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181191227 Original CRISPR CGAGCTGAGCGCGAGAGGGC GGG (reversed) Intergenic