ID: 1181191228

View in Genome Browser
Species Human (GRCh38)
Location 22:21142418-21142440
Sequence TCGAGCTGAGCGCGAGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181191228_1181191236 8 Left 1181191228 22:21142418-21142440 CCGCCCTCTCGCGCTCAGCTCGA No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191228_1181191234 7 Left 1181191228 22:21142418-21142440 CCGCCCTCTCGCGCTCAGCTCGA No data
Right 1181191234 22:21142448-21142470 CCCCCACGCGCCGATTTCCAAGG No data
1181191228_1181191240 22 Left 1181191228 22:21142418-21142440 CCGCCCTCTCGCGCTCAGCTCGA No data
Right 1181191240 22:21142463-21142485 TTCCAAGGGCCCAGCACCTAAGG No data
1181191228_1181191243 24 Left 1181191228 22:21142418-21142440 CCGCCCTCTCGCGCTCAGCTCGA No data
Right 1181191243 22:21142465-21142487 CCAAGGGCCCAGCACCTAAGGGG No data
1181191228_1181191241 23 Left 1181191228 22:21142418-21142440 CCGCCCTCTCGCGCTCAGCTCGA No data
Right 1181191241 22:21142464-21142486 TCCAAGGGCCCAGCACCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181191228 Original CRISPR TCGAGCTGAGCGCGAGAGGG CGG (reversed) Intergenic
No off target data available for this crispr