ID: 1181191229

View in Genome Browser
Species Human (GRCh38)
Location 22:21142421-21142443
Sequence TGCTCGAGCTGAGCGCGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181191229_1181191234 4 Left 1181191229 22:21142421-21142443 CCCTCTCGCGCTCAGCTCGAGCA No data
Right 1181191234 22:21142448-21142470 CCCCCACGCGCCGATTTCCAAGG No data
1181191229_1181191240 19 Left 1181191229 22:21142421-21142443 CCCTCTCGCGCTCAGCTCGAGCA No data
Right 1181191240 22:21142463-21142485 TTCCAAGGGCCCAGCACCTAAGG No data
1181191229_1181191236 5 Left 1181191229 22:21142421-21142443 CCCTCTCGCGCTCAGCTCGAGCA No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191229_1181191243 21 Left 1181191229 22:21142421-21142443 CCCTCTCGCGCTCAGCTCGAGCA No data
Right 1181191243 22:21142465-21142487 CCAAGGGCCCAGCACCTAAGGGG No data
1181191229_1181191241 20 Left 1181191229 22:21142421-21142443 CCCTCTCGCGCTCAGCTCGAGCA No data
Right 1181191241 22:21142464-21142486 TCCAAGGGCCCAGCACCTAAGGG No data
1181191229_1181191245 28 Left 1181191229 22:21142421-21142443 CCCTCTCGCGCTCAGCTCGAGCA No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181191229 Original CRISPR TGCTCGAGCTGAGCGCGAGA GGG (reversed) Intergenic