ID: 1181191236

View in Genome Browser
Species Human (GRCh38)
Location 22:21142449-21142471
Sequence CCCCACGCGCCGATTTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181191225_1181191236 21 Left 1181191225 22:21142405-21142427 CCCACGAGCTCTCCCGCCCTCTC No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191222_1181191236 30 Left 1181191222 22:21142396-21142418 CCCTCGCACCCCACGAGCTCTCC No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191228_1181191236 8 Left 1181191228 22:21142418-21142440 CCGCCCTCTCGCGCTCAGCTCGA No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191230_1181191236 4 Left 1181191230 22:21142422-21142444 CCTCTCGCGCTCAGCTCGAGCAC No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191224_1181191236 22 Left 1181191224 22:21142404-21142426 CCCCACGAGCTCTCCCGCCCTCT No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191227_1181191236 9 Left 1181191227 22:21142417-21142439 CCCGCCCTCTCGCGCTCAGCTCG No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191223_1181191236 29 Left 1181191223 22:21142397-21142419 CCTCGCACCCCACGAGCTCTCCC No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191226_1181191236 20 Left 1181191226 22:21142406-21142428 CCACGAGCTCTCCCGCCCTCTCG No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
1181191229_1181191236 5 Left 1181191229 22:21142421-21142443 CCCTCTCGCGCTCAGCTCGAGCA No data
Right 1181191236 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181191236 Original CRISPR CCCCACGCGCCGATTTCCAA GGG Intergenic
No off target data available for this crispr