ID: 1181191245

View in Genome Browser
Species Human (GRCh38)
Location 22:21142472-21142494
Sequence CCCAGCACCTAAGGGGTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181191238_1181191245 -2 Left 1181191238 22:21142451-21142473 CCACGCGCCGATTTCCAAGGGCC No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data
1181191233_1181191245 1 Left 1181191233 22:21142448-21142470 CCCCCACGCGCCGATTTCCAAGG No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data
1181191230_1181191245 27 Left 1181191230 22:21142422-21142444 CCTCTCGCGCTCAGCTCGAGCAC No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data
1181191229_1181191245 28 Left 1181191229 22:21142421-21142443 CCCTCTCGCGCTCAGCTCGAGCA No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data
1181191231_1181191245 5 Left 1181191231 22:21142444-21142466 CCGCCCCCCACGCGCCGATTTCC No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data
1181191235_1181191245 0 Left 1181191235 22:21142449-21142471 CCCCACGCGCCGATTTCCAAGGG No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data
1181191239_1181191245 -9 Left 1181191239 22:21142458-21142480 CCGATTTCCAAGGGCCCAGCACC No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data
1181191232_1181191245 2 Left 1181191232 22:21142447-21142469 CCCCCCACGCGCCGATTTCCAAG No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data
1181191237_1181191245 -1 Left 1181191237 22:21142450-21142472 CCCACGCGCCGATTTCCAAGGGC No data
Right 1181191245 22:21142472-21142494 CCCAGCACCTAAGGGGTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181191245 Original CRISPR CCCAGCACCTAAGGGGTCCG CGG Intergenic
No off target data available for this crispr