ID: 1181195907

View in Genome Browser
Species Human (GRCh38)
Location 22:21185794-21185816
Sequence CACCCCAGTGTGCCTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181195907_1181195913 17 Left 1181195907 22:21185794-21185816 CCCATGCCAGGCACACTGGGGTG No data
Right 1181195913 22:21185834-21185856 CACGATCCACTGCAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181195907 Original CRISPR CACCCCAGTGTGCCTGGCAT GGG (reversed) Intergenic
No off target data available for this crispr