ID: 1181195984

View in Genome Browser
Species Human (GRCh38)
Location 22:21186344-21186366
Sequence TCCCACCCTAGCTGAAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181195984_1181195991 13 Left 1181195984 22:21186344-21186366 CCATGGCTTCAGCTAGGGTGGGA No data
Right 1181195991 22:21186380-21186402 CTCTCTCTAATGACTTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181195984 Original CRISPR TCCCACCCTAGCTGAAGCCA TGG (reversed) Intergenic
No off target data available for this crispr