ID: 1181201405

View in Genome Browser
Species Human (GRCh38)
Location 22:21219542-21219564
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 6, 1: 0, 2: 1, 3: 9, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181201405 Original CRISPR CCCTTGGATTGCTGTGTAAG GGG (reversed) Intronic
908727517 1:67192784-67192806 GGCTTGGATTGCAGTGTAGGTGG - Intronic
918870554 1:189968500-189968522 ACCTTGGCTGGCTGTGTCAGAGG - Intergenic
919068104 1:192718864-192718886 CCTTTGGATTTCTGTGTTATTGG - Intergenic
919215482 1:194547902-194547924 CCTTTGGATTTCTGTGTTATTGG + Intergenic
920659814 1:207906248-207906270 TCCTTGGATTGCAGTGAAATTGG - Intronic
922023484 1:221728376-221728398 TCCTTGGAATCCTGTGTTAGGGG - Intronic
1062905289 10:1175722-1175744 CCCTTGTTTTGCTGTCTATGGGG + Intergenic
1064217757 10:13414875-13414897 TCCTTGAATTGATTTGTAAGTGG + Intergenic
1070014211 10:72509370-72509392 CCATTGGATAGTTGTGTAACTGG - Intronic
1072487812 10:95873317-95873339 CACTTGGATTGTTGTATAAGAGG - Exonic
1073180547 10:101580463-101580485 CCCTTGTACTGCTGTGGGAGAGG - Intronic
1073878617 10:107953204-107953226 CCCATGGATTGCTGAGTGACTGG - Intergenic
1075279533 10:121127882-121127904 CCCATGGATTGCTGTGAAGGGGG - Intergenic
1080825230 11:35842820-35842842 CCATGGGGTTGCTGTGTCAGAGG + Intergenic
1083362010 11:62115970-62115992 CCCTTGAACTGCTGCGTAATAGG + Intergenic
1084509453 11:69594080-69594102 CCCTGGGATTGCTCTGTGGGTGG + Intergenic
1089515626 11:119030048-119030070 CCCTTGTAATTCTGTGCAAGGGG + Intronic
1093944022 12:25086824-25086846 TTCTTGGAGTGCTGTGTAAAGGG + Intronic
1097699122 12:62802150-62802172 CCCTCGGATTCCTGTGGGAGAGG + Exonic
1100893645 12:99154958-99154980 CGCTTGGATGGGTGTGTAGGAGG - Intronic
1101328750 12:103740354-103740376 CCCTTAGAGTGCTCTGCAAGTGG - Intronic
1102588863 12:113942424-113942446 CCCTTGGTCTCCTGTGGAAGAGG + Exonic
1102938220 12:116915140-116915162 GGCTTGGATTCCTGTGTCAGTGG + Intronic
1105212399 13:18264886-18264908 CCCTTGGATTGCTGTGTAAGGGG - Intergenic
1107351063 13:39515203-39515225 GGCTTGGATTGCTTTGTGAGTGG - Intronic
1109082318 13:57920578-57920600 CTCCTGGATATCTGTGTAAGAGG - Intergenic
1109473804 13:62850241-62850263 CTCCTGGATTGCTCTTTAAGGGG - Intergenic
1112882983 13:104132722-104132744 CACTTGTATTTCTGTGTAAATGG - Intergenic
1115004651 14:28467846-28467868 CCCTTGGTTTTCTGTAGAAGTGG + Intergenic
1119610942 14:76061546-76061568 CGTTTGTATTGCTGTGTAACTGG + Intronic
1122328046 14:100894502-100894524 CCATGGGGTTGCTGTGTATGGGG - Intergenic
1129242004 15:74257454-74257476 CCCTGGGATTGCTGGGCAGGGGG - Intronic
1129478426 15:75803565-75803587 CCAGTGACTTGCTGTGTAAGAGG + Intergenic
1131553333 15:93376429-93376451 CCCTTTGAATGCTGTGTCTGTGG + Intergenic
1133827057 16:9287348-9287370 CCCATGTACTTCTGTGTAAGAGG + Intergenic
1135552174 16:23406903-23406925 CCCTTGTACTGCTGGGGAAGTGG + Intronic
1135778372 16:25276917-25276939 CCCGTGGATTGCAGTATTAGTGG - Intergenic
1137299116 16:47129827-47129849 TCCTTTTATTGCTGTTTAAGTGG - Intronic
1138434554 16:56989763-56989785 CCGATGGATAGCTGGGTAAGCGG + Intronic
1141107673 16:81246933-81246955 CCCTCGGCTTATTGTGTAAGTGG - Intronic
1152751341 17:82063835-82063857 CCCTTGCACTGCTGTGTGTGGGG - Intronic
1156541707 18:37918363-37918385 CTCTTGAATTGCTGAGTGAGCGG + Intergenic
1157273564 18:46294598-46294620 CCCTGGGACTGCTGTGTGTGTGG - Intergenic
1160441305 18:78894775-78894797 CCCTGGGAATCCTGTGGAAGAGG - Intergenic
1161185654 19:2917994-2918016 ACCTTGGAATGCTCTGGAAGAGG - Exonic
1161624571 19:5318879-5318901 CCCTTGAATTGCTAAGTGAGAGG + Intronic
1165419801 19:35717267-35717289 GCCGTGGATTGCAGTGGAAGGGG - Intergenic
1165990652 19:39810645-39810667 CCCTGGAAATGCCGTGTAAGCGG - Intergenic
925642130 2:5995731-5995753 CCCTTCGATGGCTGTGTGAAAGG + Intergenic
927023389 2:19041013-19041035 CTCTAGGCTTGCTGTGTTAGAGG - Intergenic
930934849 2:56936247-56936269 CCCTTGGTTTGCTTTGAATGTGG - Intergenic
934301224 2:91777516-91777538 CCCTTGGATTGCTGTGTAAGGGG + Intergenic
939968856 2:148638175-148638197 CCCTTGTATGGCTGAGTAAGAGG + Intergenic
948102695 2:235387881-235387903 CCCTAGGATTGGTGAGAAAGTGG - Intergenic
948161805 2:235830700-235830722 CACTAGGAGTGCTGTGTTAGTGG - Intronic
1170994307 20:21337244-21337266 CCCTTGGATTACTGTAAAAAAGG - Intronic
1175384184 20:58583748-58583770 CCCTTGGAGTGCTGTGTCTGGGG + Intergenic
1175721106 20:61287840-61287862 TCCTGGGGTTGCTGTGGAAGAGG + Intronic
1177901994 21:26927816-26927838 CACTTGGATTGCGGTGGGAGCGG + Intronic
1179530501 21:42015387-42015409 ACTTTGGGTTGCTGTGTAAATGG + Intergenic
1180815215 22:18785205-18785227 CCCTTGGATTGCTGTGTAAGGGG - Intergenic
1181201405 22:21219542-21219564 CCCTTGGATTGCTGTGTAAGGGG - Intronic
1181700344 22:24617421-24617443 CCCGTGGGTTGCTGTGTAAGGGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1203225509 22_KI270731v1_random:75888-75910 CCCTTGGATTGCTGTGTAAGGGG + Intergenic
1203265321 22_KI270734v1_random:10896-10918 CCCTTGGATTGCTGTGTAAGGGG - Intergenic
951632194 3:24734489-24734511 ACCTTGGATTGCTTTCTCAGTGG - Intergenic
955800419 3:62680600-62680622 CCCCTGGACTGCTGTGATAGTGG + Intronic
960707338 3:120493774-120493796 CCATTGGATTGCTGTCTCAGTGG - Intergenic
967523570 3:190465949-190465971 CACTTGGATTGGTATCTAAGAGG - Intergenic
968469406 4:772180-772202 CAGTTGCATTTCTGTGTAAGCGG - Intergenic
968655063 4:1774892-1774914 CCCTTGGACTGCAGTGGGAGGGG - Intergenic
973613530 4:52658830-52658852 CCCTCGGGTTGCGGTGGAAGCGG - Intronic
977680075 4:99788713-99788735 CACTGGGATTGCTGGGTCAGGGG + Intergenic
978451787 4:108841893-108841915 CTCTTGGATTGCTCTGTAATAGG + Intronic
980468149 4:133213468-133213490 GCCTTGAATACCTGTGTAAGAGG + Intergenic
983464061 4:168064406-168064428 CCATTGCATTGATCTGTAAGTGG - Intergenic
985570279 5:641056-641078 ACCTTGGATTTCTGTGTATTGGG + Intronic
990484793 5:56247563-56247585 CCATTGGATTGCCGTGGAAGAGG - Intergenic
991457355 5:66818703-66818725 CCCTTGGATTGCTGCTGCAGTGG + Intronic
995253172 5:110017696-110017718 TCTTTGGATGGCTGTGTCAGTGG - Intergenic
1001323110 5:170699022-170699044 CCCTGGGATGGATGTGGAAGGGG - Intronic
1002679287 5:180948614-180948636 CCGTTGGTTTGCTGTGTGTGTGG + Intronic
1002685164 5:181004111-181004133 CCGTTGGTTTGCTGTGTGTGTGG + Intronic
1006034290 6:31199486-31199508 ACCTTGGATTGCTGGGTCGGGGG + Intronic
1007197913 6:40079076-40079098 CCTATGGATTACTTTGTAAGTGG - Intergenic
1028355888 7:89907272-89907294 CCCTTGTATTTCTGTGAAATTGG - Intergenic
1028971627 7:96865277-96865299 CCCTAGAATTCCTGTGTAAGAGG - Intergenic
1029700555 7:102244056-102244078 CCCTTGGCCTGCTGGGTGAGTGG - Intronic
1031246640 7:119321529-119321551 AACTTACATTGCTGTGTAAGTGG - Intergenic
1032403715 7:131641039-131641061 CCCTTGGACTGTTGGGGAAGAGG + Intergenic
1033564116 7:142562140-142562162 CCATGGGATTGATGGGTAAGAGG - Intergenic
1037572824 8:20173028-20173050 CCTTGGGGTTGCTGGGTAAGTGG - Exonic
1038510198 8:28126648-28126670 CTTTTGGATGGCTGTCTAAGTGG + Intronic
1041779682 8:61564024-61564046 CTGATGGATTGCTGTGGAAGAGG + Intronic
1042795773 8:72662137-72662159 CCCATGGATTGCTATGGGAGTGG - Intronic
1050021534 9:1289644-1289666 TCATTTGAATGCTGTGTAAGTGG + Intergenic
1051023069 9:12569131-12569153 CCCTTGCATAGGTGTGTAAGGGG + Intergenic
1055701092 9:78946727-78946749 CCCTTGGACTGCTGTGCCTGTGG - Intergenic
1057593617 9:96395341-96395363 CTCTGGGATTGCTGTGCAGGGGG - Intronic
1059329347 9:113525106-113525128 CCCTTGGGTTGGTGTGGGAGAGG + Intronic
1060237199 9:121873037-121873059 CCCTTAAATTACTGGGTAAGTGG + Intronic
1061206508 9:129167038-129167060 CCCTTGGATGGGTGTGTTTGTGG + Intergenic
1061829294 9:133280581-133280603 CCTTTGGATTGCTATCTCAGTGG + Intergenic
1186325935 X:8476707-8476729 CCCTTGGTTTTCTATGTGAGAGG + Intergenic
1193343808 X:80382937-80382959 CCCTTGGCTTCCTGGGTGAGGGG + Intronic
1193709539 X:84862598-84862620 CCCTAGGATTTCTGTGTAGTGGG + Intergenic
1201918775 Y:19211696-19211718 TCCTTGGATTTTGGTGTAAGTGG - Intergenic