ID: 1181203259

View in Genome Browser
Species Human (GRCh38)
Location 22:21231534-21231556
Sequence CCTTCTTTGCAGGAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181203259_1181203266 -7 Left 1181203259 22:21231534-21231556 CCATCCATCTCCTGCAAAGAAGG No data
Right 1181203266 22:21231550-21231572 AAGAAGGCTGGAGGCAGGTCAGG No data
1181203259_1181203267 -6 Left 1181203259 22:21231534-21231556 CCATCCATCTCCTGCAAAGAAGG No data
Right 1181203267 22:21231551-21231573 AGAAGGCTGGAGGCAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181203259 Original CRISPR CCTTCTTTGCAGGAGATGGA TGG (reversed) Intergenic
No off target data available for this crispr