ID: 1181205762

View in Genome Browser
Species Human (GRCh38)
Location 22:21251013-21251035
Sequence TATCCAAGGCTTCTAAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181205755_1181205762 27 Left 1181205755 22:21250963-21250985 CCGGAGATTCCACTTTGCCAATC No data
Right 1181205762 22:21251013-21251035 TATCCAAGGCTTCTAAAGTCTGG No data
1181205757_1181205762 10 Left 1181205757 22:21250980-21251002 CCAATCACATCAAGTCCAAACTC No data
Right 1181205762 22:21251013-21251035 TATCCAAGGCTTCTAAAGTCTGG No data
1181205759_1181205762 -5 Left 1181205759 22:21250995-21251017 CCAAACTCCGTGTCTTGGTATCC No data
Right 1181205762 22:21251013-21251035 TATCCAAGGCTTCTAAAGTCTGG No data
1181205756_1181205762 18 Left 1181205756 22:21250972-21250994 CCACTTTGCCAATCACATCAAGT No data
Right 1181205762 22:21251013-21251035 TATCCAAGGCTTCTAAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181205762 Original CRISPR TATCCAAGGCTTCTAAAGTC TGG Intergenic
No off target data available for this crispr