ID: 1181207963

View in Genome Browser
Species Human (GRCh38)
Location 22:21268061-21268083
Sequence CCCCACGCGCCGATTTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181207963_1181207971 8 Left 1181207963 22:21268061-21268083 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1181207971 22:21268092-21268114 TCGAGCTGAGCGCGAGAGGGCGG No data
1181207963_1181207977 30 Left 1181207963 22:21268061-21268083 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1181207977 22:21268114-21268136 GGAGAGCTCGTGGGGTGCGAGGG No data
1181207963_1181207974 21 Left 1181207963 22:21268061-21268083 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1181207974 22:21268105-21268127 GAGAGGGCGGGAGAGCTCGTGGG No data
1181207963_1181207970 5 Left 1181207963 22:21268061-21268083 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1181207970 22:21268089-21268111 TGCTCGAGCTGAGCGCGAGAGGG No data
1181207963_1181207973 20 Left 1181207963 22:21268061-21268083 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1181207973 22:21268104-21268126 CGAGAGGGCGGGAGAGCTCGTGG No data
1181207963_1181207972 9 Left 1181207963 22:21268061-21268083 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1181207972 22:21268093-21268115 CGAGCTGAGCGCGAGAGGGCGGG No data
1181207963_1181207976 29 Left 1181207963 22:21268061-21268083 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1181207976 22:21268113-21268135 GGGAGAGCTCGTGGGGTGCGAGG No data
1181207963_1181207975 22 Left 1181207963 22:21268061-21268083 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1181207975 22:21268106-21268128 AGAGGGCGGGAGAGCTCGTGGGG No data
1181207963_1181207969 4 Left 1181207963 22:21268061-21268083 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1181207969 22:21268088-21268110 GTGCTCGAGCTGAGCGCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181207963 Original CRISPR CCCCACGCGCCGATTTCCAA GGG (reversed) Intergenic
No off target data available for this crispr