ID: 1181210042

View in Genome Browser
Species Human (GRCh38)
Location 22:21284071-21284093
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181210042_1181210046 2 Left 1181210042 22:21284071-21284093 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181210046 22:21284096-21284118 CAGCTGCAGCAGGTGCCCAGAGG No data
1181210042_1181210049 30 Left 1181210042 22:21284071-21284093 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181210049 22:21284124-21284146 ACCAGAGATCCCAGACCTCCCGG No data
1181210042_1181210043 -8 Left 1181210042 22:21284071-21284093 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181210043 22:21284086-21284108 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181210042 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr