ID: 1181210043

View in Genome Browser
Species Human (GRCh38)
Location 22:21284086-21284108
Sequence GCCTCAGCCACAGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181210032_1181210043 28 Left 1181210032 22:21284035-21284057 CCCCACGTTGGGGTCACTACTGG No data
Right 1181210043 22:21284086-21284108 GCCTCAGCCACAGCTGCAGCAGG No data
1181210035_1181210043 26 Left 1181210035 22:21284037-21284059 CCACGTTGGGGTCACTACTGGAG No data
Right 1181210043 22:21284086-21284108 GCCTCAGCCACAGCTGCAGCAGG No data
1181210034_1181210043 27 Left 1181210034 22:21284036-21284058 CCCACGTTGGGGTCACTACTGGA No data
Right 1181210043 22:21284086-21284108 GCCTCAGCCACAGCTGCAGCAGG No data
1181210041_1181210043 -7 Left 1181210041 22:21284070-21284092 CCCTTCACATTTCTGGGCCTCAG No data
Right 1181210043 22:21284086-21284108 GCCTCAGCCACAGCTGCAGCAGG No data
1181210042_1181210043 -8 Left 1181210042 22:21284071-21284093 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181210043 22:21284086-21284108 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181210043 Original CRISPR GCCTCAGCCACAGCTGCAGC AGG Intergenic
No off target data available for this crispr