ID: 1181210046

View in Genome Browser
Species Human (GRCh38)
Location 22:21284096-21284118
Sequence CAGCTGCAGCAGGTGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181210042_1181210046 2 Left 1181210042 22:21284071-21284093 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181210046 22:21284096-21284118 CAGCTGCAGCAGGTGCCCAGAGG No data
1181210041_1181210046 3 Left 1181210041 22:21284070-21284092 CCCTTCACATTTCTGGGCCTCAG No data
Right 1181210046 22:21284096-21284118 CAGCTGCAGCAGGTGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181210046 Original CRISPR CAGCTGCAGCAGGTGCCCAG AGG Intergenic
No off target data available for this crispr