ID: 1181210049

View in Genome Browser
Species Human (GRCh38)
Location 22:21284124-21284146
Sequence ACCAGAGATCCCAGACCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181210047_1181210049 -10 Left 1181210047 22:21284111-21284133 CCCAGAGGTCAGAACCAGAGATC No data
Right 1181210049 22:21284124-21284146 ACCAGAGATCCCAGACCTCCCGG No data
1181210045_1181210049 8 Left 1181210045 22:21284093-21284115 CCACAGCTGCAGCAGGTGCCCAG No data
Right 1181210049 22:21284124-21284146 ACCAGAGATCCCAGACCTCCCGG No data
1181210042_1181210049 30 Left 1181210042 22:21284071-21284093 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181210049 22:21284124-21284146 ACCAGAGATCCCAGACCTCCCGG No data
1181210044_1181210049 14 Left 1181210044 22:21284087-21284109 CCTCAGCCACAGCTGCAGCAGGT No data
Right 1181210049 22:21284124-21284146 ACCAGAGATCCCAGACCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181210049 Original CRISPR ACCAGAGATCCCAGACCTCC CGG Intergenic
No off target data available for this crispr