ID: 1181213171

View in Genome Browser
Species Human (GRCh38)
Location 22:21303739-21303761
Sequence CTCTGCAAGCAGCTGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181213168_1181213171 -9 Left 1181213168 22:21303725-21303747 CCTCCTCAGGAGGACTCTGCAAG No data
Right 1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG No data
1181213163_1181213171 17 Left 1181213163 22:21303699-21303721 CCTTCTCCAGGGAGCCACGGGGC No data
Right 1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG No data
1181213164_1181213171 11 Left 1181213164 22:21303705-21303727 CCAGGGAGCCACGGGGCTTTCCT No data
Right 1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG No data
1181213157_1181213171 28 Left 1181213157 22:21303688-21303710 CCCTCAATGCTCCTTCTCCAGGG No data
Right 1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG No data
1181213166_1181213171 3 Left 1181213166 22:21303713-21303735 CCACGGGGCTTTCCTCCTCAGGA No data
Right 1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG No data
1181213159_1181213171 27 Left 1181213159 22:21303689-21303711 CCTCAATGCTCCTTCTCCAGGGA No data
Right 1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181213171 Original CRISPR CTCTGCAAGCAGCTGGATGA AGG Intergenic
No off target data available for this crispr