ID: 1181213537

View in Genome Browser
Species Human (GRCh38)
Location 22:21306744-21306766
Sequence CTCTCTCTAATGACTTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181213537_1181213549 26 Left 1181213537 22:21306744-21306766 CCAGGATAAGTCATTAGAGAGAG No data
Right 1181213549 22:21306793-21306815 GAAGCCATGGTGCTTCGCACAGG No data
1181213537_1181213544 13 Left 1181213537 22:21306744-21306766 CCAGGATAAGTCATTAGAGAGAG No data
Right 1181213544 22:21306780-21306802 TCCCACCCTAGCTGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181213537 Original CRISPR CTCTCTCTAATGACTTATCC TGG (reversed) Intergenic
No off target data available for this crispr