ID: 1181213544

View in Genome Browser
Species Human (GRCh38)
Location 22:21306780-21306802
Sequence TCCCACCCTAGCTGAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181213537_1181213544 13 Left 1181213537 22:21306744-21306766 CCAGGATAAGTCATTAGAGAGAG No data
Right 1181213544 22:21306780-21306802 TCCCACCCTAGCTGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181213544 Original CRISPR TCCCACCCTAGCTGAAGCCA TGG Intergenic
No off target data available for this crispr