ID: 1181213621

View in Genome Browser
Species Human (GRCh38)
Location 22:21307330-21307352
Sequence CACCCCAGTGTGCCTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181213615_1181213621 17 Left 1181213615 22:21307290-21307312 CCTCTGCATTGCAGTGGATCGTG No data
Right 1181213621 22:21307330-21307352 CACCCCAGTGTGCCTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181213621 Original CRISPR CACCCCAGTGTGCCTGGCAT GGG Intergenic
No off target data available for this crispr