ID: 1181217594

View in Genome Browser
Species Human (GRCh38)
Location 22:21343940-21343962
Sequence GACACTGGGGGGTTTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181217594_1181217600 -10 Left 1181217594 22:21343940-21343962 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1181217600 22:21343953-21343975 CCCCAGTGTCTTTGGCAGCAGGG No data
1181217594_1181217603 -2 Left 1181217594 22:21343940-21343962 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1181217603 22:21343961-21343983 TCTTTGGCAGCAGGGCCGAGAGG No data
1181217594_1181217604 10 Left 1181217594 22:21343940-21343962 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1181217604 22:21343973-21343995 GGGCCGAGAGGACGAAGCCCCGG No data
1181217594_1181217606 19 Left 1181217594 22:21343940-21343962 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1181217606 22:21343982-21344004 GGACGAAGCCCCGGCCTTCCTGG No data
1181217594_1181217607 24 Left 1181217594 22:21343940-21343962 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1181217607 22:21343987-21344009 AAGCCCCGGCCTTCCTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181217594 Original CRISPR GACACTGGGGGGTTTCTTCC TGG (reversed) Intergenic
No off target data available for this crispr