ID: 1181218548

View in Genome Browser
Species Human (GRCh38)
Location 22:21352156-21352178
Sequence TATTTCAGCAGAAACCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181218548_1181218549 -1 Left 1181218548 22:21352156-21352178 CCTGCAGGGTTTCTGCTGAAATA No data
Right 1181218549 22:21352178-21352200 ATCCACTGATAATCTTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181218548 Original CRISPR TATTTCAGCAGAAACCCTGC AGG (reversed) Intergenic
No off target data available for this crispr