ID: 1181221151

View in Genome Browser
Species Human (GRCh38)
Location 22:21365225-21365247
Sequence ACACCCTCCCAGCCAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181221151_1181221154 15 Left 1181221151 22:21365225-21365247 CCAGCGGCTGGCTGGGAGGGTGT No data
Right 1181221154 22:21365263-21365285 CGGCCAGCTTAGTCTACTCTAGG No data
1181221151_1181221153 -5 Left 1181221151 22:21365225-21365247 CCAGCGGCTGGCTGGGAGGGTGT No data
Right 1181221153 22:21365243-21365265 GGTGTGTGTTAGCATGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181221151 Original CRISPR ACACCCTCCCAGCCAGCCGC TGG (reversed) Intergenic
No off target data available for this crispr