ID: 1181221617

View in Genome Browser
Species Human (GRCh38)
Location 22:21367573-21367595
Sequence GAGGGTGTGCACAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181221600_1181221617 21 Left 1181221600 22:21367529-21367551 CCTGTAGCACTGCAAACACAGGC No data
Right 1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG No data
1181221598_1181221617 22 Left 1181221598 22:21367528-21367550 CCCTGTAGCACTGCAAACACAGG No data
Right 1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG No data
1181221597_1181221617 25 Left 1181221597 22:21367525-21367547 CCACCCTGTAGCACTGCAAACAC No data
Right 1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181221617 Original CRISPR GAGGGTGTGCACAAGGGGCA GGG Intergenic
No off target data available for this crispr