ID: 1181221689

View in Genome Browser
Species Human (GRCh38)
Location 22:21367905-21367927
Sequence GAGTTGTGAAGGGTGGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181221689_1181221696 1 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221696 22:21367929-21367951 CTTCCCCTCCCAGCACCACAGGG No data
1181221689_1181221706 19 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221689_1181221710 30 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221710 22:21367958-21367980 CTGGCCCCTGGGACCTCCCATGG No data
1181221689_1181221703 11 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221703 22:21367939-21367961 CAGCACCACAGGGGCCCTCCTGG No data
1181221689_1181221705 18 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221705 22:21367946-21367968 ACAGGGGCCCTCCTGGCCCCTGG No data
1181221689_1181221695 0 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221695 22:21367928-21367950 TCTTCCCCTCCCAGCACCACAGG No data
1181221689_1181221697 2 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221697 22:21367930-21367952 TTCCCCTCCCAGCACCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181221689 Original CRISPR GAGTTGTGAAGGGTGGGTTT GGG (reversed) Intergenic
No off target data available for this crispr