ID: 1181221695

View in Genome Browser
Species Human (GRCh38)
Location 22:21367928-21367950
Sequence TCTTCCCCTCCCAGCACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181221691_1181221695 -6 Left 1181221691 22:21367911-21367933 CCCACCCTTCACAACTCTCTTCC No data
Right 1181221695 22:21367928-21367950 TCTTCCCCTCCCAGCACCACAGG No data
1181221693_1181221695 -10 Left 1181221693 22:21367915-21367937 CCCTTCACAACTCTCTTCCCCTC No data
Right 1181221695 22:21367928-21367950 TCTTCCCCTCCCAGCACCACAGG No data
1181221689_1181221695 0 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221695 22:21367928-21367950 TCTTCCCCTCCCAGCACCACAGG No data
1181221688_1181221695 7 Left 1181221688 22:21367898-21367920 CCAGGGACCCAAACCCACCCTTC No data
Right 1181221695 22:21367928-21367950 TCTTCCCCTCCCAGCACCACAGG No data
1181221692_1181221695 -7 Left 1181221692 22:21367912-21367934 CCACCCTTCACAACTCTCTTCCC No data
Right 1181221695 22:21367928-21367950 TCTTCCCCTCCCAGCACCACAGG No data
1181221690_1181221695 -1 Left 1181221690 22:21367906-21367928 CCAAACCCACCCTTCACAACTCT No data
Right 1181221695 22:21367928-21367950 TCTTCCCCTCCCAGCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181221695 Original CRISPR TCTTCCCCTCCCAGCACCAC AGG Intergenic
No off target data available for this crispr