ID: 1181221699

View in Genome Browser
Species Human (GRCh38)
Location 22:21367933-21367955
Sequence GGGCCCCTGTGGTGCTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181221699_1181221714 8 Left 1181221699 22:21367933-21367955 CCCTCCCAGCACCACAGGGGCCC No data
Right 1181221714 22:21367964-21367986 CCTGGGACCTCCCATGGAGCAGG No data
1181221699_1181221706 -9 Left 1181221699 22:21367933-21367955 CCCTCCCAGCACCACAGGGGCCC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221699_1181221705 -10 Left 1181221699 22:21367933-21367955 CCCTCCCAGCACCACAGGGGCCC No data
Right 1181221705 22:21367946-21367968 ACAGGGGCCCTCCTGGCCCCTGG No data
1181221699_1181221719 25 Left 1181221699 22:21367933-21367955 CCCTCCCAGCACCACAGGGGCCC No data
Right 1181221719 22:21367981-21368003 AGCAGGCTCTCTGTCCAGGATGG No data
1181221699_1181221718 21 Left 1181221699 22:21367933-21367955 CCCTCCCAGCACCACAGGGGCCC No data
Right 1181221718 22:21367977-21367999 ATGGAGCAGGCTCTCTGTCCAGG No data
1181221699_1181221710 2 Left 1181221699 22:21367933-21367955 CCCTCCCAGCACCACAGGGGCCC No data
Right 1181221710 22:21367958-21367980 CTGGCCCCTGGGACCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181221699 Original CRISPR GGGCCCCTGTGGTGCTGGGA GGG (reversed) Intergenic
No off target data available for this crispr