ID: 1181221703

View in Genome Browser
Species Human (GRCh38)
Location 22:21367939-21367961
Sequence CAGCACCACAGGGGCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181221693_1181221703 1 Left 1181221693 22:21367915-21367937 CCCTTCACAACTCTCTTCCCCTC No data
Right 1181221703 22:21367939-21367961 CAGCACCACAGGGGCCCTCCTGG No data
1181221694_1181221703 0 Left 1181221694 22:21367916-21367938 CCTTCACAACTCTCTTCCCCTCC No data
Right 1181221703 22:21367939-21367961 CAGCACCACAGGGGCCCTCCTGG No data
1181221688_1181221703 18 Left 1181221688 22:21367898-21367920 CCAGGGACCCAAACCCACCCTTC No data
Right 1181221703 22:21367939-21367961 CAGCACCACAGGGGCCCTCCTGG No data
1181221692_1181221703 4 Left 1181221692 22:21367912-21367934 CCACCCTTCACAACTCTCTTCCC No data
Right 1181221703 22:21367939-21367961 CAGCACCACAGGGGCCCTCCTGG No data
1181221689_1181221703 11 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221703 22:21367939-21367961 CAGCACCACAGGGGCCCTCCTGG No data
1181221690_1181221703 10 Left 1181221690 22:21367906-21367928 CCAAACCCACCCTTCACAACTCT No data
Right 1181221703 22:21367939-21367961 CAGCACCACAGGGGCCCTCCTGG No data
1181221691_1181221703 5 Left 1181221691 22:21367911-21367933 CCCACCCTTCACAACTCTCTTCC No data
Right 1181221703 22:21367939-21367961 CAGCACCACAGGGGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181221703 Original CRISPR CAGCACCACAGGGGCCCTCC TGG Intergenic
No off target data available for this crispr