ID: 1181221706

View in Genome Browser
Species Human (GRCh38)
Location 22:21367947-21367969
Sequence CAGGGGCCCTCCTGGCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181221691_1181221706 13 Left 1181221691 22:21367911-21367933 CCCACCCTTCACAACTCTCTTCC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221692_1181221706 12 Left 1181221692 22:21367912-21367934 CCACCCTTCACAACTCTCTTCCC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221693_1181221706 9 Left 1181221693 22:21367915-21367937 CCCTTCACAACTCTCTTCCCCTC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221688_1181221706 26 Left 1181221688 22:21367898-21367920 CCAGGGACCCAAACCCACCCTTC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221690_1181221706 18 Left 1181221690 22:21367906-21367928 CCAAACCCACCCTTCACAACTCT No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221700_1181221706 -10 Left 1181221700 22:21367934-21367956 CCTCCCAGCACCACAGGGGCCCT No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221698_1181221706 -8 Left 1181221698 22:21367932-21367954 CCCCTCCCAGCACCACAGGGGCC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221694_1181221706 8 Left 1181221694 22:21367916-21367938 CCTTCACAACTCTCTTCCCCTCC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221689_1181221706 19 Left 1181221689 22:21367905-21367927 CCCAAACCCACCCTTCACAACTC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data
1181221699_1181221706 -9 Left 1181221699 22:21367933-21367955 CCCTCCCAGCACCACAGGGGCCC No data
Right 1181221706 22:21367947-21367969 CAGGGGCCCTCCTGGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181221706 Original CRISPR CAGGGGCCCTCCTGGCCCCT GGG Intergenic
No off target data available for this crispr