ID: 1181221931

View in Genome Browser
Species Human (GRCh38)
Location 22:21368911-21368933
Sequence CACCTTGAGAAGCTGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181221920_1181221931 27 Left 1181221920 22:21368861-21368883 CCTGGGGCCAGCTCTGACTCCCT No data
Right 1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG No data
1181221921_1181221931 20 Left 1181221921 22:21368868-21368890 CCAGCTCTGACTCCCTGCAAGTG No data
Right 1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG No data
1181221926_1181221931 7 Left 1181221926 22:21368881-21368903 CCTGCAAGTGTGGCAAGGGTCCC No data
Right 1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG No data
1181221925_1181221931 8 Left 1181221925 22:21368880-21368902 CCCTGCAAGTGTGGCAAGGGTCC No data
Right 1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG No data
1181221919_1181221931 28 Left 1181221919 22:21368860-21368882 CCCTGGGGCCAGCTCTGACTCCC No data
Right 1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181221931 Original CRISPR CACCTTGAGAAGCTGCAGCT GGG Intergenic
No off target data available for this crispr