ID: 1181224892

View in Genome Browser
Species Human (GRCh38)
Location 22:21385271-21385293
Sequence GCGCGCTCGCCTGCTCCGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 3, 1: 0, 2: 0, 3: 3, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181224892_1181224898 16 Left 1181224892 22:21385271-21385293 CCTGTCGGAGCAGGCGAGCGCGC 0: 3
1: 0
2: 0
3: 3
4: 39
Right 1181224898 22:21385310-21385332 GCAGATCGAAGAGCTGCGGCAGG 0: 3
1: 0
2: 0
3: 9
4: 104
1181224892_1181224897 12 Left 1181224892 22:21385271-21385293 CCTGTCGGAGCAGGCGAGCGCGC 0: 3
1: 0
2: 0
3: 3
4: 39
Right 1181224897 22:21385306-21385328 ACAAGCAGATCGAAGAGCTGCGG 0: 3
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181224892 Original CRISPR GCGCGCTCGCCTGCTCCGAC AGG (reversed) Exonic
900284128 1:1891144-1891166 GCGCGCTCGCCAGGCCCGACGGG + Intergenic
901641435 1:10694903-10694925 GCGCGCTCGCATGCTGCCAGCGG + Intronic
915492516 1:156259034-156259056 GCAGGCTCTCCTGCTCAGACTGG + Exonic
1071856576 10:89631513-89631535 GCTAGCTTGCCTGCTCCCACTGG + Intronic
1073544657 10:104338106-104338128 GCGCGGGCGCCTGCTCCTCCCGG - Intronic
1077081290 11:725835-725857 GCGGGCTCACCTGCTCGAACGGG - Exonic
1083700883 11:64477024-64477046 GCCCGCTGGCCTGCACCGGCTGG + Intergenic
1085011031 11:73142013-73142035 GCCCGCTGGCCTGCTCCCTCCGG - Exonic
1087036124 11:93758322-93758344 GGGCTCTCGCCTGTTCCCACTGG - Intronic
1089350130 11:117817332-117817354 GGGCCCTCACCTGCTCCGCCTGG + Intronic
1091286635 11:134411973-134411995 GCGCGCCCGCCCGCCCCGCCCGG + Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1100632213 12:96400262-96400284 TCGCGCCCGGCTGCTCCGAGGGG - Exonic
1103488180 12:121296718-121296740 GCGCGCTCCTCTCCTCCGCCCGG + Intronic
1109776945 13:67053067-67053089 GAGCTCTCTCCTGCTCCTACTGG - Intronic
1118019349 14:61695408-61695430 GCCCGCTCGCCTGCCCAGGCCGG - Intergenic
1118827557 14:69398004-69398026 GCGCGCCCGCCTGCTCGCTCGGG - Intronic
1120190589 14:81436282-81436304 GCGCGCTCGCCTCCTGCTGCGGG + Intronic
1123039334 14:105483963-105483985 GCGCCCTGGCCTGCTCCTGCTGG - Intergenic
1127884742 15:63189476-63189498 GCGCGCAGGCCTTCTCCGAGAGG + Exonic
1132566520 16:625964-625986 ACGCGCGGGCCTGCTCCGTCGGG - Exonic
1132641813 16:981593-981615 GCGCCCCCGCCTGCCCCGCCCGG - Intergenic
1132779223 16:1613981-1614003 GCGGGCTCGCCTGCCCGCACGGG - Intronic
1136462135 16:30418148-30418170 GCGTGCGCGCGTGCTCCGCCAGG - Exonic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1141957915 16:87384516-87384538 CCGCGCACGCCTGCTCCAGCTGG + Intronic
1151966195 17:77433044-77433066 GTGCTCTCAGCTGCTCCGACAGG + Intronic
1152729066 17:81961050-81961072 CCGCGCGCGCCTTCTCCGCCAGG - Exonic
1156219979 18:35041448-35041470 GCTCGCTCGCCTGCTCCGCACGG - Exonic
1161572001 19:5035887-5035909 GCGCGCGCGCCTGCGCGCACAGG + Intronic
1162373990 19:10294467-10294489 CCGCGCTGGCCTGCGCCGCCCGG + Exonic
1168345346 19:55648075-55648097 GGGCGCTAGCCTGGCCCGACTGG + Intronic
1174204160 20:48827433-48827455 GCGCACGGTCCTGCTCCGACCGG - Intronic
1180796832 22:18610000-18610022 GCGCGCTCGCCTGCTCCGACAGG + Exonic
1181224892 22:21385271-21385293 GCGCGCTCGCCTGCTCCGACAGG - Exonic
1181253740 22:21549542-21549564 GCGCGCTCGCCTGCTCCGACAGG + Exonic
954401280 3:50321158-50321180 GCGCGCTCGCCTCCCCCGCCCGG + Exonic
959941599 3:112086671-112086693 GCGCGCTCGAGTGCTCTGAATGG + Intronic
966418014 3:179708945-179708967 GCGCACTCACCTGCCCCGTCAGG - Exonic
975605268 4:76148419-76148441 GCGCGCTCCCCTTCTCAGTCCGG + Exonic
1004044447 6:12011769-12011791 GCGCGGCCGCCAGCTCTGACCGG - Intronic
1006119532 6:31795623-31795645 GCCCGCTCGACTCCTCCGCCCGG - Exonic
1018400138 6:163413978-163414000 GCGCGCTCGCGGGGCCCGACGGG + Intronic
1040081659 8:43291887-43291909 GCGCTCTAGCCTGCTACAACAGG + Intergenic
1040915718 8:52565149-52565171 GCGCGCTCCCCTGCGCCCCCGGG + Exonic