ID: 1181225094

View in Genome Browser
Species Human (GRCh38)
Location 22:21386310-21386332
Sequence TCCCTGGCCCTGGAAATGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 3, 1: 0, 2: 2, 3: 24, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181225085_1181225094 12 Left 1181225085 22:21386275-21386297 CCAGTGAGGTGGATGACCTGGAG 0: 3
1: 0
2: 1
3: 15
4: 184
Right 1181225094 22:21386310-21386332 TCCCTGGCCCTGGAAATGGGGGG 0: 3
1: 0
2: 2
3: 24
4: 303
1181225086_1181225094 -4 Left 1181225086 22:21386291-21386313 CCTGGAGCCTGACAGCGTGTCCC 0: 3
1: 0
2: 1
3: 8
4: 137
Right 1181225094 22:21386310-21386332 TCCCTGGCCCTGGAAATGGGGGG 0: 3
1: 0
2: 2
3: 24
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181225094 Original CRISPR TCCCTGGCCCTGGAAATGGG GGG Exonic
900506640 1:3032651-3032673 TGGCTGGCCCTGGAGATGGCCGG - Intergenic
900947792 1:5841033-5841055 TCTCTGGGCCTGGACATGGCTGG + Intergenic
901101934 1:6725769-6725791 GCCCTGGTTCTGGAGATGGGTGG + Intergenic
901123903 1:6915985-6916007 TCCCTGGCACTTGGAGTGGGTGG + Intronic
901207092 1:7503525-7503547 CACCTGACCCTGGAAATGGTGGG - Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902596995 1:17516395-17516417 TCTCTGGCCCTGTAGAGGGGAGG - Intergenic
903340463 1:22651168-22651190 CACCTGGCCCTGGACATGGCAGG + Intergenic
903602683 1:24554071-24554093 TCTCTGACCCTGGTTATGGGAGG + Intergenic
905933011 1:41802991-41803013 TCCCTGCCCCTGGCAATGCTGGG + Intronic
906143194 1:43545736-43545758 TCCTCAGACCTGGAAATGGGGGG + Intronic
906317715 1:44799154-44799176 TCTCTGGCCCTGGGAAGGGTGGG + Intergenic
907719146 1:56955073-56955095 TCCCTGGGGCTGGAAAGAGGGGG + Intronic
907959814 1:59268344-59268366 TCCCTGGTCTTGGAGGTGGGAGG - Intergenic
910358949 1:86395834-86395856 TACCTGGCCTGGGAAAAGGGCGG - Intronic
912746637 1:112250660-112250682 GCCCAGGCTCAGGAAATGGGTGG - Intergenic
914448520 1:147771065-147771087 TCCCTGTCCCTGAAAACGGCAGG + Intronic
914901684 1:151714565-151714587 CCCCTGGCCCTGCAAAGGGCAGG + Intronic
915433549 1:155885913-155885935 TCCCTAGACCTGAACATGGGAGG + Intergenic
915462782 1:156080187-156080209 TCCAAAGCCCTGGAATTGGGTGG - Intronic
915915356 1:159937394-159937416 TCCCTGGCCAGGGAAGTGGGTGG - Intronic
917454059 1:175170701-175170723 GGCCTGGCCATGGAAATGGTGGG - Intronic
917981333 1:180271568-180271590 TCCCAGGCCCGGGACAGGGGTGG + Intronic
918238208 1:182600062-182600084 TCACAGGTCCTGGAAGTGGGCGG + Exonic
919922046 1:202171807-202171829 TCCCTGGCCCTGCAGCTGGAAGG + Intergenic
922117976 1:222633090-222633112 TAACTGGCCCTGGAATTGGGAGG - Exonic
922339355 1:224643194-224643216 TCCTGGGCCCTGGGAATAGGGGG + Intronic
922851239 1:228735609-228735631 TCCCCGGCCCTGGAGAGTGGCGG - Exonic
923870006 1:237981706-237981728 TCCCTGTCTCTGGGATTGGGAGG + Intergenic
1062848435 10:725690-725712 TGCCTGGCCCTGGGAAGGGCTGG - Intergenic
1063553576 10:7056695-7056717 TGCCAGGGCCTGGGAATGGGAGG + Intergenic
1063921864 10:10941318-10941340 CCCTTGACCCTGGAACTGGGTGG + Intergenic
1065814323 10:29470578-29470600 TCCCTGGCCCTGGACGGAGGTGG - Intronic
1065864321 10:29900602-29900624 TCCATGGCCCTAGAGATTGGTGG - Intergenic
1068104611 10:52598361-52598383 TCCCTGCCCCTGGAAAAGATGGG + Intergenic
1069167733 10:65184548-65184570 TGCCTGGAACTGGGAATGGGAGG - Intergenic
1070529729 10:77326008-77326030 TTCCTGTCCTTAGAAATGGGGGG - Intronic
1070633427 10:78105067-78105089 ACCCTGGCCCTAGAAATTTGTGG + Intergenic
1070797263 10:79223915-79223937 TCCCAGGCCAAGGAATTGGGGGG + Intronic
1070830037 10:79412469-79412491 GCCCAGTCCCTGGAGATGGGTGG - Intronic
1075072393 10:119327657-119327679 CCCCCGGCCCTGGAAACTGGTGG - Intronic
1075213845 10:120514983-120515005 TCCCTTACCATGGAAAAGGGAGG - Intronic
1076594455 10:131617341-131617363 TCTCTGGAAATGGAAATGGGAGG - Intergenic
1076603447 10:131674220-131674242 TCCCTGTCCCTGAAAATGTGAGG - Intergenic
1077182033 11:1221024-1221046 TGCCTGGCCCTGTACCTGGGTGG - Intergenic
1077241934 11:1515187-1515209 TCCCGGGCCCTCGACCTGGGAGG + Intergenic
1077935898 11:6785341-6785363 TTCCTGGCACTGACAATGGGTGG + Exonic
1081640326 11:44748870-44748892 TCTCTGTCCCTGGAAGTGGGTGG - Intronic
1081770474 11:45647594-45647616 TTCCAGGCACTGGAAGTGGGTGG + Intergenic
1081848421 11:46258016-46258038 TCCCTGGCCCTGGAAAGTCTTGG + Intergenic
1082770325 11:57202837-57202859 TCCCTGGGGCTGGAGCTGGGGGG - Intergenic
1083866440 11:65456198-65456220 TGGCTGGCCCTGGAAGAGGGAGG - Intergenic
1084077378 11:66790725-66790747 GCCGTGGCCATGGAAATAGGTGG + Intronic
1084106623 11:66984772-66984794 TCCCCAGCCCTGGAAGTGTGAGG - Intergenic
1084383121 11:68826067-68826089 TCCCTGGCCCTGGAGAGTAGAGG + Intronic
1084632757 11:70365331-70365353 TCCCTTGCCCTGGATGTGGTTGG + Intronic
1084998920 11:73011306-73011328 GCCCTGCCACTGGAAAAGGGAGG + Intronic
1085037215 11:73307841-73307863 TCTCTGGGCCGGGAAAGGGGTGG - Intergenic
1089162842 11:116452779-116452801 TCCTTGGCCATGGGAATGCGGGG - Intergenic
1089397193 11:118144155-118144177 TTCCTGGTCCTGGACAGGGGAGG - Intronic
1089608257 11:119654506-119654528 TACCTGGCCCTCAGAATGGGAGG + Intronic
1089617481 11:119703103-119703125 TCCCAGGGCCTGCACATGGGAGG + Intronic
1089876575 11:121727544-121727566 TCCCTGCCCTTGGAAATGAATGG + Intergenic
1090381795 11:126332549-126332571 TCCCTGGCCCAGAAGAAGGGAGG + Intronic
1090972747 11:131656989-131657011 TCCCTGGCTCTGGAACTGAGGGG + Intronic
1092015340 12:5154035-5154057 TCCCTGGGCTTGGGAATGGGGGG + Intergenic
1092289252 12:7149416-7149438 TCCCTGGCCCTGGAAAGGGAGGG + Intronic
1092447184 12:8568317-8568339 TGCCTGGCCCTGTACCTGGGAGG + Intergenic
1102786404 12:115608523-115608545 TCCAAGGCCCTGGAATTTGGAGG - Intergenic
1102816223 12:115868540-115868562 TCCCTGGTCCTGGAGGTGGGAGG + Intergenic
1103593294 12:122007417-122007439 TCCCTGGCCCTTGACAGGGGAGG - Intergenic
1104566187 12:129886625-129886647 TCCCTGGCCCTGGCGATGCATGG - Intronic
1104721611 12:131047664-131047686 TCCCTGGCACTGACAATGGCTGG - Intronic
1104785308 12:131444818-131444840 GCCATGGCCCTGGGGATGGGGGG - Intergenic
1104990034 12:132619716-132619738 TCCCTGGGTCTGGGAGTGGGTGG - Exonic
1106476760 13:30105594-30105616 TCCCGGGCCCTGGAGGTAGGAGG - Intergenic
1108886719 13:55194483-55194505 TCCCAGCCCCTATAAATGGGAGG + Intergenic
1112072802 13:95873728-95873750 TCCCTGGCTCTTCCAATGGGGGG - Intronic
1112497471 13:99916246-99916268 TCCCTGGGACTGGGAGTGGGAGG - Intergenic
1112562619 13:100527434-100527456 TCCCTGACCCTGGAGAAGTGGGG - Intronic
1114643868 14:24242646-24242668 TCCCTTGCCCCGGAAAAGGGCGG + Exonic
1114669277 14:24400153-24400175 TCCCAGCCCTTGGAGATGGGTGG + Intronic
1116222791 14:42110794-42110816 TGCCTGGCCATGGAACAGGGAGG + Intergenic
1118317223 14:64732689-64732711 CTCCTGGCCCTGGAGCTGGGTGG + Intronic
1118320472 14:64749515-64749537 TGCCTGGCCCGGGAGGTGGGGGG - Exonic
1118745213 14:68768397-68768419 TCCCTGGCTCTGGGATTGTGGGG - Intergenic
1121541106 14:94727380-94727402 TCCAAGCCCCTGGAATTGGGGGG - Intergenic
1121714146 14:96060732-96060754 TCCCTGGCACTGGGCACGGGTGG - Intronic
1122079089 14:99254493-99254515 TTGCTGGCCCTGGAAAAGGCAGG + Intronic
1122549935 14:102544412-102544434 TCCCTTGCCAGGGAACTGGGAGG + Intergenic
1123006455 14:105326190-105326212 TCCCTGGTCCTGGATACAGGTGG + Intronic
1123006477 14:105326257-105326279 TTCCTGGTCCTGGACACGGGTGG + Intronic
1123935919 15:25194041-25194063 TCTCCGTCCCTGGAAATGGGTGG + Intergenic
1124412068 15:29444893-29444915 ACCCTGGCTCTAGAAAAGGGAGG + Intronic
1124654706 15:31498920-31498942 TGCCTAGCCTGGGAAATGGGAGG + Intronic
1125159585 15:36627745-36627767 GCCCTGGCCCTGGTGATGGTTGG - Intronic
1125478212 15:40062031-40062053 ACCCTGGCCATGGGAGTGGGAGG + Intergenic
1125495027 15:40185305-40185327 TCTTTGGCCCTGGGCATGGGGGG - Exonic
1128224772 15:65994036-65994058 TCTGGAGCCCTGGAAATGGGAGG - Intronic
1128889312 15:71316705-71316727 TCCCTGGACCTGGGAAAGGCTGG + Intronic
1128898626 15:71398754-71398776 GCCCTGGTGCTGGACATGGGAGG - Intronic
1128989645 15:72248993-72249015 GGCTTGGCCCTGGGAATGGGTGG - Intronic
1129071402 15:72954300-72954322 TCCCTGTCCTTGTACATGGGAGG - Intergenic
1129364737 15:75047387-75047409 TCCCTGTCCCTGGGACTTGGGGG + Intronic
1132481504 16:168550-168572 TGCCTGGCACAGGAAAGGGGAGG - Intergenic
1132640498 16:976172-976194 TCCGTGGCCCAGGCACTGGGGGG - Intronic
1132746656 16:1439020-1439042 TTCCTGGCCCTGGAGAAGGTGGG - Exonic
1134329347 16:13236175-13236197 ACCATGACCGTGGAAATGGGAGG + Exonic
1134417589 16:14057944-14057966 CCCCTGGCTCTGGGAATGGCAGG - Intergenic
1134822205 16:17256119-17256141 ACCCTGTCCCTGCAGATGGGGGG + Intronic
1136551899 16:30986344-30986366 TCCCTGGACCTGGGATGGGGAGG + Intronic
1137593304 16:49707065-49707087 TCGCAGGCCATGGAAAGGGGTGG - Intronic
1137915875 16:52429400-52429422 TCCTTGGCCCTGGAGGAGGGAGG - Intergenic
1138194688 16:55043577-55043599 TCCTAGGCCCAGGAAGTGGGTGG - Intergenic
1139322984 16:66130335-66130357 TCCCTGGACCTGGAGACAGGAGG + Intergenic
1139967127 16:70751858-70751880 GCCCTGGCCTGGGAAAGGGGTGG + Intronic
1140046434 16:71442872-71442894 GCCCTGGGCCTGGAAGGGGGAGG - Intergenic
1141252599 16:82371783-82371805 TCCCTAGCCCTGGCAATTGCTGG + Intergenic
1142185055 16:88690920-88690942 TCTCTGGCCCCTGACATGGGCGG + Intergenic
1142387431 16:89774767-89774789 TCCCTGGCCCTGCAGGTGGAAGG + Intronic
1142800810 17:2344351-2344373 TCCCTGTCCCTTCAGATGGGGGG - Intronic
1143803150 17:9401987-9402009 TCCCTGCCTCTGGAAATTGCTGG - Intronic
1147008866 17:37427606-37427628 GCCCTGGCCATGGGAGTGGGTGG + Intronic
1147257632 17:39191632-39191654 TCCCAGGCCCAGGAGCTGGGAGG - Intronic
1147426380 17:40347765-40347787 TCCCTGGCCCTGGGATTGTTTGG + Intronic
1147791370 17:43016072-43016094 TCTCTGGCCCTGGAACCAGGAGG + Exonic
1148447125 17:47744596-47744618 TCCCTGCCCCTGAAAACAGGAGG + Intronic
1148486200 17:47992274-47992296 ACCCTGGCATGGGAAATGGGAGG + Intergenic
1149447449 17:56724645-56724667 CTCCAGGCCCTGGTAATGGGAGG + Intergenic
1150248202 17:63691520-63691542 TCCCTGCTCCTGGATTTGGGTGG + Intronic
1151256883 17:72884297-72884319 GCACTGGCCCTGCAAATGGCTGG - Intronic
1151542832 17:74773532-74773554 CCCCTAGCCCTGGTACTGGGAGG - Intronic
1152043949 17:77923760-77923782 TGGCTGGCCCTGCAAATGGAGGG + Intergenic
1152187409 17:78866522-78866544 TCCCTGGCAGTGGAATTGGTGGG - Intronic
1153381370 18:4443388-4443410 TCCCTGGCTCTGCCAATGGTTGG - Intronic
1156400041 18:36731765-36731787 CCCATGGCCCTGGGAATGGGAGG + Intronic
1157426809 18:47591313-47591335 TCCATGACCATGGAAATGGAAGG - Intergenic
1157505434 18:48222947-48222969 TCCCTGCCCCTGGAGCTGTGTGG + Intronic
1157741873 18:50100688-50100710 TCCCTAGACCTGGAAAAGAGAGG - Intronic
1158920557 18:62187166-62187188 TATCTGGCGCTGGGAATGGGCGG + Intergenic
1160802116 19:974935-974957 ATGCTGGCCGTGGAAATGGGAGG + Exonic
1160939760 19:1614750-1614772 CCCCTGGCCCTGGGAAATGGGGG + Intronic
1160958584 19:1706770-1706792 TCCCGGGCCCTGGGAAGGTGGGG + Intergenic
1161015488 19:1980862-1980884 AGCCTGGCCCTGGCAAGGGGCGG + Exonic
1161153893 19:2722484-2722506 TCCAGGGCCATGGAAATGGTGGG - Intronic
1161320313 19:3637958-3637980 CACCTGGCCCTGGAGAAGGGAGG - Intronic
1161381270 19:3966344-3966366 TCAGTGGCCCAGGAAAGGGGTGG + Intronic
1161410519 19:4114557-4114579 TCCCTGGCCCAGGTAACGCGGGG + Intronic
1161723217 19:5914940-5914962 TCCCGGGCCTGGGACATGGGGGG - Exonic
1161731472 19:5963619-5963641 TGGATGTCCCTGGAAATGGGGGG - Intronic
1161943185 19:7418658-7418680 TCCCTGGCTCTGGATCTCGGAGG + Intronic
1162006523 19:7783917-7783939 TCCCTGGCCCAGGACAAGGAAGG - Intergenic
1162721717 19:12666726-12666748 TCCCCGGCCCTGGAAAGGCCGGG + Exonic
1162924548 19:13923646-13923668 TCCCTGGCCCTGGGGATGGGTGG - Intronic
1163019681 19:14475463-14475485 TCTCTGCTCCTGGCAATGGGCGG + Intergenic
1165821962 19:38682475-38682497 TACCTGGCCCTGTAGAGGGGAGG + Intronic
1165948213 19:39458031-39458053 GCACTGGCCCAGGAAGTGGGGGG - Intronic
1165987970 19:39787205-39787227 CCCCTAGCTCTGGAAATGGAAGG + Intergenic
1167420669 19:49401183-49401205 TCCCTGGCTCTGGAAGGGTGTGG - Intronic
925006209 2:444869-444891 ACCCTGGCCCTGGAGGTGAGGGG + Intergenic
925180557 2:1814385-1814407 TCCCGGGACGTGGACATGGGCGG + Intronic
926059508 2:9796366-9796388 TCCCTGGCCCTGGCTGTAGGAGG + Intergenic
926279168 2:11430875-11430897 TCCCTGCTCCTGGGAATGGCTGG + Intergenic
926600971 2:14844811-14844833 TCCCTGCCATTGGAAAGGGGAGG + Intergenic
926967036 2:18426152-18426174 TTCATGGCCCTGGAAATGGAAGG - Intergenic
927412767 2:22845566-22845588 TACCTGGCCCTTTAAATGAGGGG + Intergenic
927801454 2:26103742-26103764 TCCCTGGCCAGGGAATTGGGAGG - Intronic
928170395 2:28999498-28999520 GCCCTTGACCTGGAAGTGGGTGG - Intronic
928581227 2:32709662-32709684 TCCCTATCACTGGATATGGGCGG + Intronic
929565284 2:42979966-42979988 GACCTGGCCCTGCAAGTGGGTGG + Intergenic
931637320 2:64352194-64352216 TCCTTTGCCTTGGAAAGGGGAGG + Intergenic
931709429 2:64975455-64975477 ACACTGGCCCTGGGCATGGGAGG + Intergenic
933744189 2:85558660-85558682 TCCCTGGACCAGGATATGGTTGG + Intronic
935173761 2:100630099-100630121 CCCATGGCCCTGGGGATGGGAGG + Intergenic
936411406 2:112261260-112261282 TCCCTGAACCTGGAAATGTTGGG + Intergenic
937622205 2:124001766-124001788 TCCCTGGTTCTAGAAATGGCCGG - Intergenic
937911914 2:127079991-127080013 GCCCCCGCCTTGGAAATGGGAGG + Intronic
941553846 2:166950794-166950816 TCCCTGGCCTTGAAAATGATTGG - Intronic
946021446 2:216643090-216643112 TTCCTGGTGCAGGAAATGGGTGG - Intronic
946193894 2:218022040-218022062 TCCCTGGCACTGGCATCGGGGGG + Intergenic
946937305 2:224735668-224735690 TCCCCTGCCCTGGAAATCTGTGG + Intergenic
947715482 2:232336908-232336930 TCCTCTGCCCAGGAAATGGGGGG + Exonic
948861300 2:240753921-240753943 ACCCTGGCCCTAGAAGTAGGTGG - Intronic
948887223 2:240890358-240890380 TCCCTGGCCCTGAATACGGAGGG + Intronic
1168874205 20:1159509-1159531 TCTCTGGCCCACGAAATGTGGGG - Intronic
1170899659 20:20449391-20449413 TGCCTGGCCATGGAAATGAAGGG + Intronic
1172804045 20:37598458-37598480 TCCCATCCCCTTGAAATGGGAGG - Intergenic
1173135306 20:40433737-40433759 CCCACAGCCCTGGAAATGGGAGG + Intergenic
1173910066 20:46661622-46661644 TCCCAGGTGCAGGAAATGGGGGG - Intronic
1174513931 20:51076750-51076772 TTCCTGCCCCAGGAATTGGGAGG - Intergenic
1175546322 20:59780376-59780398 TCCCTGTCTCTGGAACTGTGAGG - Intronic
1175687171 20:61039998-61040020 TCCCTGGCCTAGGACATAGGAGG - Intergenic
1176144375 20:63559103-63559125 TCCCTGGGGCAGGAAGTGGGTGG - Intronic
1176293478 21:5058641-5058663 ATCCTGGACCTGGAAAGGGGAGG + Intergenic
1176886435 21:14261375-14261397 TCCTTCCCCCTGCAAATGGGGGG - Intergenic
1179437342 21:41370919-41370941 TTCCTGGAGTTGGAAATGGGTGG + Intronic
1179789422 21:43747895-43747917 TCCCTGGACCAGGAAATCGAAGG - Intronic
1179863782 21:44205007-44205029 ATCCTGGACCTGGAAAGGGGAGG - Intergenic
1180150072 21:45942925-45942947 ACCCAGGCCCAGGGAATGGGGGG + Intergenic
1180599602 22:17007585-17007607 TCCCAGGCCCTGAGAATGGCGGG - Intronic
1180796630 22:18608961-18608983 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181225094 22:21386310-21386332 TCCCTGGCCCTGGAAATGGGGGG + Exonic
1181253538 22:21548503-21548525 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181510584 22:23387050-23387072 ACCCTGGCCCTGGACAGGGTGGG + Intergenic
1182995438 22:34807949-34807971 TCCCTAGCCCAGGCAATGCGGGG + Intergenic
1183191151 22:36322752-36322774 TCCATGGCCCTGGAAACGGCAGG + Intronic
1183304736 22:37076539-37076561 GCCCATGCCCTGGAGATGGGAGG - Intronic
1183620173 22:38967515-38967537 TCCCAGGCCCTGGGAAGGGAAGG - Intronic
1183623800 22:38989739-38989761 TGCTTGGCCCTGGAGTTGGGGGG + Intronic
1183727373 22:39597274-39597296 TCCCTGGTCCTGTGACTGGGAGG + Intronic
1184100620 22:42340149-42340171 TCCCTGGGCCTGGGAATGTCTGG - Intronic
1184145912 22:42610407-42610429 TCCTTGGAGCTGGAAGTGGGAGG - Intronic
1184451694 22:44586322-44586344 CTCCTGGCCCTGGGAGTGGGTGG - Intergenic
1185171503 22:49297255-49297277 TCCCTGGCCCTGGCATCGGTGGG + Intergenic
1185264075 22:49889112-49889134 GCCCAGGCCCTGGAAAAGGGAGG - Exonic
1185338905 22:50282994-50283016 GCCCTGGCCCTGGGTATGGAGGG - Intronic
949591330 3:5497141-5497163 TCCCTGGCCTTGTTTATGGGTGG - Intergenic
953362350 3:42309232-42309254 TCTCTGCCTGTGGAAATGGGAGG - Intergenic
953692391 3:45130760-45130782 TCCCTGGGCCTTGTAAGGGGAGG + Intronic
954189895 3:48951547-48951569 TCCCTGGGCCTGGAACTTGGTGG + Intronic
954692315 3:52402154-52402176 GTCCAGGCCCTGGGAATGGGAGG - Exonic
955693540 3:61613540-61613562 TACCTGGCACTGTAATTGGGTGG - Intronic
959808256 3:110585073-110585095 TGCCTGGCACTGGGGATGGGTGG - Intergenic
960785759 3:121371755-121371777 GCCCTGGCCTTGGCACTGGGCGG - Intronic
960938587 3:122918915-122918937 TCTCTGACTGTGGAAATGGGTGG + Intronic
962349790 3:134648352-134648374 TCACTGGCACTGGCTATGGGGGG - Intronic
962379691 3:134888078-134888100 TCCCTGTCCTTGAAAACGGGTGG + Intronic
962741534 3:138365831-138365853 GCCGTGGCTCTGGGAATGGGGGG + Intronic
968298111 3:197592836-197592858 ATCCTGGCCCTGGAAGTGGGGGG + Intergenic
968955467 4:3716721-3716743 TGGCTGGCCCTGGAGATGAGGGG + Intergenic
970107475 4:12601295-12601317 TCCGTGTCCCTGCAAATGAGAGG - Intergenic
970237238 4:13971316-13971338 TTTCTGGACCTGGAAAAGGGAGG - Intergenic
971346310 4:25815056-25815078 TCCCTGGCCTAGGAGATGGCAGG - Intronic
975815577 4:78213275-78213297 TCCCTTGCAATGCAAATGGGGGG - Intronic
977566305 4:98584011-98584033 CCCCTGGCCTTTGGAATGGGGGG - Intronic
978371715 4:108035998-108036020 GCCCTTGTCCTGGAAATGGCAGG + Intergenic
978385012 4:108169384-108169406 TCCCTGGCTCTGGCAGAGGGAGG + Intergenic
978705043 4:111698285-111698307 TCTCTGGCTCTGCAAATGGTTGG - Intergenic
981634784 4:146864244-146864266 TTCCTGGCTGTGGAACTGGGTGG - Intronic
982131635 4:152233967-152233989 GCCCTTGACCTGGAAATGGCTGG + Intergenic
982714826 4:158795941-158795963 TCCCTGGTCCTGGAAAAGGTTGG + Intronic
983679586 4:170337846-170337868 TCCATGGCTCTGGAAATGTCTGG - Intergenic
984682466 4:182625487-182625509 TCCCTGGACCAGGAATAGGGGGG - Intronic
985656734 5:1135754-1135776 TCCCTCGCCCTGGTAAGGGCAGG + Intergenic
987967445 5:24894342-24894364 TCCCTTGCCCTAGAAATCTGTGG - Intergenic
988691714 5:33579077-33579099 TCCCTGGACCTAGAAAGGGAAGG + Intronic
994126750 5:96176118-96176140 TCCCAGGCCCAGGGAATAGGAGG + Intergenic
998204226 5:140147681-140147703 TCCCTGGCCCTGCAAAGGCAAGG + Intergenic
998258544 5:140609473-140609495 TCCCTGGCATTGGAAAGGAGGGG + Intergenic
999199491 5:149805859-149805881 GCCCTGGGCTTTGAAATGGGAGG - Intronic
999448844 5:151663678-151663700 CCCCTGCCCCTGGGGATGGGTGG - Intronic
999804713 5:155070991-155071013 TCCCTGGTCATGGAACTGGAAGG + Intergenic
999984683 5:156991908-156991930 TCCCTTTCCATGGACATGGGGGG + Intergenic
1000036131 5:157449566-157449588 GGCCTGGCCCTGGAACTGGTAGG + Intronic
1001565165 5:172695428-172695450 TCCCTGTCCCTGGAATTGAACGG - Intergenic
1002018150 5:176342512-176342534 TCCCAGCCTCTGGAACTGGGTGG - Intronic
1002101944 5:176862143-176862165 TCCCTGGCCCTGCACATAGTAGG - Intronic
1002107471 5:176887304-176887326 TTCCTGGCCCTGGACCTCGGGGG - Exonic
1002340375 5:178512886-178512908 TCCCTGACCTGGAAAATGGGAGG - Intronic
1002668661 5:180846799-180846821 TCCCTGTCCCAGGTACTGGGTGG - Intergenic
1002712357 5:181203025-181203047 TCCCTGGCTCTGGCAGAGGGAGG - Intronic
1004201869 6:13555972-13555994 TCACTGGTCATGGAAAAGGGAGG - Intergenic
1004348109 6:14866897-14866919 TCCCTGGACATGGGAGTGGGGGG - Intergenic
1004417157 6:15435483-15435505 TCCCTAGCACTGGCACTGGGAGG - Intronic
1006283306 6:33073661-33073683 CCTCTAGCACTGGAAATGGGTGG + Exonic
1006605328 6:35252049-35252071 GCTCTGAGCCTGGAAATGGGAGG + Exonic
1006804878 6:36781637-36781659 TCCCTGTCCCAGGACATGGATGG - Intronic
1007640368 6:43334250-43334272 CCCCTGGCCTTGCAAATGGGGGG - Intronic
1009353365 6:62709179-62709201 CCCCTGCCTGTGGAAATGGGAGG - Intergenic
1011798070 6:90979579-90979601 TCACTGGCTATGGAAATGTGGGG - Intergenic
1018094649 6:160374652-160374674 CCCCTGGCTTTGGAGATGGGGGG + Intronic
1018742926 6:166744273-166744295 TCCCTGGCTCTCCAACTGGGAGG + Intronic
1019365402 7:630174-630196 GCCCTGGTCCTGGAAGGGGGAGG - Intronic
1020886550 7:13825130-13825152 TCCCTGGCACTGAAAATGAAAGG + Intergenic
1021931991 7:25590152-25590174 TCTCTGGCACTGGAAAAGTGAGG - Intergenic
1022470674 7:30680335-30680357 ACCCAGGCCCTGGGAAGGGGGGG + Intronic
1022507196 7:30914587-30914609 ACACTGGCCCTGGAACTGGAGGG + Intronic
1022523613 7:31023292-31023314 CCTCTGGCCCTGAAAGTGGGAGG - Intergenic
1023888976 7:44379499-44379521 TGCCTGGCTCTGCCAATGGGAGG + Exonic
1024995695 7:55271751-55271773 TGCTGGGACCTGGAAATGGGAGG + Intergenic
1027201062 7:76064223-76064245 TCCCATGCCCTGGTGATGGGAGG + Intronic
1029116394 7:98239769-98239791 TCCCTGGCCCGGGGGATGGACGG - Intronic
1030685717 7:112485193-112485215 TTTCTGTCCCTGGAAAGGGGTGG + Intronic
1031901404 7:127415242-127415264 TTCCTGGCCCAGGCAAAGGGCGG + Intronic
1032609291 7:133393758-133393780 TCCCAGCCTCTGGAAATGTGAGG + Intronic
1032892418 7:136212809-136212831 TCCCAGGCTCCGGAACTGGGAGG - Intergenic
1032944065 7:136829600-136829622 TCCCAAGTCCTGGAAATGAGAGG + Intergenic
1033394097 7:140957205-140957227 TCGCCGGCCCTGGCAATGAGGGG - Intergenic
1034484416 7:151349666-151349688 TACCTGGCCATGGCAATGAGAGG - Intronic
1035727760 8:1835154-1835176 TCCATGGCCCTGCAAAGGTGGGG - Intronic
1037724952 8:21475321-21475343 TTCCTCGCTCTGGAAATGTGTGG - Intergenic
1037889902 8:22618559-22618581 TCCCCGACCCTGGCCATGGGCGG - Intronic
1038351612 8:26781058-26781080 TTCATGGGCCTGGAGATGGGAGG - Intronic
1039394934 8:37217430-37217452 TAACTGGCCCAGGAAATAGGAGG + Intergenic
1039951081 8:42173204-42173226 CCCCTGGGGATGGAAATGGGAGG - Intergenic
1040341353 8:46442734-46442756 TCCCTGCCCAAGGAAATGTGAGG + Intergenic
1043015858 8:74940142-74940164 TGCCTGGATCTGGACATGGGGGG + Intergenic
1043042140 8:75276465-75276487 CCCCTGGCCCTGGAAAGGTCTGG - Intergenic
1044930466 8:97247129-97247151 ACCCTGGACCTGGTAATAGGGGG + Intergenic
1048333857 8:133489129-133489151 TCCCTGGGGCTGGAAATGGTGGG - Intronic
1049340499 8:142109806-142109828 TCCCTGTCCATGGAAAGGAGCGG - Intergenic
1049596244 8:143484826-143484848 TCCCAGGGCCTGGGAGTGGGGGG - Intronic
1049753685 8:144298051-144298073 AACCTGCCACTGGAAATGGGAGG - Intronic
1050362562 9:4844593-4844615 TCCCTGGCCCTGGGGGTTGGAGG - Exonic
1052283899 9:26762791-26762813 ACCCTGGCTCTGGAAATATGAGG - Intergenic
1056235135 9:84586793-84586815 TCCCTGACTCTAGAGATGGGAGG - Intergenic
1056743053 9:89276542-89276564 TCCCTTGCCCTGGAGATCTGTGG - Intergenic
1058068131 9:100572084-100572106 TCCATGGCCCGGGAGTTGGGGGG + Intronic
1059474096 9:114530028-114530050 TCCCTGGACCAGGGAAAGGGTGG - Intergenic
1059860840 9:118459750-118459772 TCCCTGGCCCAACAAATGGCAGG - Intergenic
1060671534 9:125474149-125474171 TGCCTGGCTCTGGAATTGGAGGG + Intronic
1060758943 9:126232824-126232846 TCCCTTGCCCTGAACTTGGGAGG - Intergenic
1060812272 9:126616464-126616486 TGCCTGGCACTGCAATTGGGAGG + Intronic
1060939859 9:127536908-127536930 TCCTGGGCCCAGGAACTGGGGGG + Intronic
1060945183 9:127566344-127566366 TCCCTGGCCTGGGATCTGGGAGG - Intronic
1061004069 9:127918451-127918473 TCCCAGCCCCTGGATAGGGGAGG - Intergenic
1061008669 9:127942705-127942727 TCCCTTGCCCTGGTGGTGGGGGG - Exonic
1061085078 9:128393669-128393691 TGCCTGGCCCAGGAGAAGGGAGG - Intergenic
1061135816 9:128732715-128732737 CCCCTGGCCCAGGAAGTGGCTGG + Intronic
1061488856 9:130934246-130934268 GCCCTGGCCCTGGCAGAGGGAGG + Intronic
1061791822 9:133063134-133063156 TCCCTGGCCCTGGGACCGGGAGG + Intronic
1061795497 9:133083700-133083722 TCCCTGGCCCTGGGACCGGGAGG + Intronic
1062013682 9:134280596-134280618 TACCTGGCCCTGGCAAGGGTAGG + Intergenic
1062239094 9:135526330-135526352 TCCCCTGCCCTGGAAAGGGGGGG - Exonic
1062544228 9:137054401-137054423 TCCCGGGCCCGGGAAAAGCGCGG - Intergenic
1185735075 X:2490057-2490079 GCCCAGGCCCAGGAAGTGGGCGG + Exonic
1186873791 X:13797550-13797572 TCCATGGACCAGGCAATGGGGGG - Intronic
1191178228 X:57529523-57529545 TGTGTGGCCCTGGAAATGAGAGG - Intergenic
1192435615 X:71141875-71141897 CCCCTGGCGCTGGAACTGGGTGG - Exonic
1195988945 X:110663665-110663687 TCACAGGCCCTGGATATTGGAGG + Intergenic
1198567403 X:137918456-137918478 GCCCTGGCACTGGAAAGGTGAGG - Intergenic
1200097753 X:153672120-153672142 TACCTGGCCATGGAACTGTGAGG - Exonic