ID: 1181225464

View in Genome Browser
Species Human (GRCh38)
Location 22:21388070-21388092
Sequence GAGCTTGTCCTTGCCTGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 3, 1: 0, 2: 1, 3: 11, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181225464_1181225470 -6 Left 1181225464 22:21388070-21388092 CCACAGCAGGCAAGGACAAGCTC 0: 3
1: 0
2: 1
3: 11
4: 163
Right 1181225470 22:21388087-21388109 AAGCTCTGGGGGTGAAGAGAGGG 0: 3
1: 0
2: 3
3: 30
4: 430
1181225464_1181225472 19 Left 1181225464 22:21388070-21388092 CCACAGCAGGCAAGGACAAGCTC 0: 3
1: 0
2: 1
3: 11
4: 163
Right 1181225472 22:21388112-21388134 CCAGCTCCATGAGCCCAGCTCGG 0: 3
1: 0
2: 1
3: 36
4: 271
1181225464_1181225469 -7 Left 1181225464 22:21388070-21388092 CCACAGCAGGCAAGGACAAGCTC 0: 3
1: 0
2: 1
3: 11
4: 163
Right 1181225469 22:21388086-21388108 CAAGCTCTGGGGGTGAAGAGAGG 0: 3
1: 0
2: 5
3: 32
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181225464 Original CRISPR GAGCTTGTCCTTGCCTGCTG TGG (reversed) Exonic
900163616 1:1236085-1236107 GAGCCCTTCCTTGCCTGGTGGGG - Intergenic
901621419 1:10591263-10591285 CACCTTGTACTTGGCTGCTGTGG + Intronic
901864665 1:12096890-12096912 TTGCTTTTCCTTGCCTGCTAGGG + Intronic
904006029 1:27363742-27363764 GAGCATGTCGCTGCCTCCTGGGG - Intronic
905199183 1:36305092-36305114 GTCCTTGTGCTTGCCTTCTGGGG + Exonic
906459908 1:46029258-46029280 GAGCTTTGCAGTGCCTGCTGTGG + Intronic
906652105 1:47520217-47520239 GTCACTGTCCTTGCCTGCTGAGG + Intergenic
906807190 1:48790599-48790621 GAGTTTGTCATTGACTGCTATGG + Intronic
910408632 1:86915716-86915738 GACCTTGTAATTGCCAGCTGAGG + Intronic
912455555 1:109794500-109794522 GTGCTTGGACTTGGCTGCTGTGG - Intergenic
913072614 1:115314276-115314298 GAGCTTGGCTTTGCATGCTCAGG + Intronic
913254906 1:116944614-116944636 GGGCTGGCCCTTGCCGGCTGGGG + Intronic
913333383 1:117685716-117685738 AATCTTGTCCTGGCCTGCAGGGG + Intergenic
914229297 1:145750447-145750469 GATCTTTTCCTTGTCAGCTGGGG + Exonic
914389907 1:147211208-147211230 GAGCTTGGCCTTACCTGCTCTGG - Intronic
915117072 1:153607909-153607931 GAGGGTGTCTTTCCCTGCTGAGG - Intronic
915862686 1:159463116-159463138 GTGCTGCTCCTTCCCTGCTGGGG - Intergenic
919126332 1:193397499-193397521 GGGCTTGTACTTGCCTTCTTCGG + Intergenic
922466104 1:225846329-225846351 GTCCTTGTCCCTGCCTGCTATGG + Exonic
924433948 1:244022112-244022134 GCCCCTCTCCTTGCCTGCTGTGG + Intergenic
924953841 1:248908848-248908870 GTGCTATTCCCTGCCTGCTGAGG + Intronic
1062858853 10:794356-794378 CAGCTTGTCGTTTCCTGCCGGGG - Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067168132 10:43881760-43881782 AAGCCTCCCCTTGCCTGCTGGGG - Intergenic
1067693749 10:48520739-48520761 CAGCTCTTCCTTGCCTTCTGGGG - Intronic
1068086620 10:52381539-52381561 GAGGTTGAACTTGCCTGGTGAGG - Intergenic
1068549578 10:58391324-58391346 AAGCTTGTCAATCCCTGCTGTGG + Intronic
1069620599 10:69835133-69835155 CAGCTTGTCCCAGGCTGCTGGGG + Intronic
1071479594 10:86055005-86055027 GAGCCTGGGCTAGCCTGCTGGGG + Intronic
1075201831 10:120411015-120411037 GACCTGGTCCTTGCCTTTTGAGG + Intergenic
1077042332 11:530289-530311 GTGCTGGTCACTGCCTGCTGGGG - Intergenic
1077290493 11:1788158-1788180 CAGCTTGTCCATGCCTGGTGTGG + Intergenic
1077408548 11:2393198-2393220 GAGATGGCCCCTGCCTGCTGAGG + Intronic
1077483630 11:2828178-2828200 GTGCTAGTCCCTGCCTGCTGAGG - Intronic
1078356926 11:10639355-10639377 GAGGTTCTCCTTGTCTGCTAGGG - Intronic
1080829339 11:35876862-35876884 GAGCTTGTCCTTGACATGTGAGG - Intergenic
1082183362 11:49147599-49147621 GAGTTTGTCCTTCTCTTCTGTGG - Intronic
1083272503 11:61579553-61579575 CAGCCTGTCCCTGCCTCCTGAGG - Intronic
1083724723 11:64622219-64622241 GAGCCTCTCCTTGTTTGCTGGGG - Intronic
1084020742 11:66416236-66416258 GGCCATGCCCTTGCCTGCTGAGG + Intergenic
1084971833 11:72776310-72776332 TAGCTTGGCTCTGCCTGCTGTGG - Intronic
1086403026 11:86476194-86476216 ACACTTGACCTTGCCTGCTGTGG + Intronic
1089112108 11:116065218-116065240 GAGCTTGGCCTTAGCTGCCGTGG - Intergenic
1089748691 11:120634951-120634973 GAGCTTCGCCTTGGCAGCTGGGG + Intronic
1098198471 12:68028139-68028161 GAGCTTCTCCTGGCTTGCTCTGG - Intergenic
1098289139 12:68938546-68938568 GAGCATGTCCTTACCTCCTTAGG + Intronic
1100641128 12:96483259-96483281 GAGCTTGTAATTTCCTGCTCAGG - Intergenic
1101794460 12:107960173-107960195 GAGCCTTCCCTTGCCTGCTGCGG + Intergenic
1103511374 12:121476973-121476995 GAGCTTTTCCTTGTCAACTGGGG - Intronic
1104730535 12:131103135-131103157 GCGCAGGTCCTTGCCTGCTGAGG + Intronic
1104935976 12:132364697-132364719 GCCCCTGTCCCTGCCTGCTGCGG - Intergenic
1106080065 13:26492934-26492956 GGGCTGGTCTTTGCATGCTGTGG - Intergenic
1113643672 13:111976547-111976569 GATCTTTTCCTGGCCTGTTGGGG + Intergenic
1128984571 15:72209915-72209937 GAGCTTTTCCATTCCTTCTGAGG - Intronic
1129666405 15:77581960-77581982 GAGCTTGGCCTTGTCAGCCGGGG - Intergenic
1132686333 16:1163662-1163684 GAACTTGTCCCGGGCTGCTGGGG + Intronic
1136656388 16:31711731-31711753 GCACCTGTCCGTGCCTGCTGTGG + Intergenic
1137600003 16:49750090-49750112 GAGCTTGCACTTGCCTGCACAGG - Intronic
1138157166 16:54716450-54716472 GAATTTGACCTTGCCAGCTGCGG - Intergenic
1138566578 16:57837817-57837839 GAGGTTGGCTCTGCCTGCTGTGG - Intronic
1139911459 16:70399924-70399946 GAGCCTGTCAGTGCCTGCAGAGG + Exonic
1141962758 16:87420555-87420577 CAGCCTGTCCTTGCCAGCTGTGG + Intronic
1142933784 17:3310511-3310533 GAACTTGTCCCTGCCAGATGTGG + Intergenic
1144341019 17:14310334-14310356 GGGCTTGTCAGTGCCTGCTCTGG - Intronic
1146292685 17:31621905-31621927 GAGCTTTTCCTAGCCCCCTGAGG + Intergenic
1147132019 17:38415249-38415271 GACCATGTCCGTGTCTGCTGCGG + Intergenic
1148381865 17:47205671-47205693 GAGCGTCTCCTCCCCTGCTGGGG + Intronic
1151480946 17:74369767-74369789 CAGCTTTTCGTTTCCTGCTGAGG - Intronic
1152351370 17:79785629-79785651 GAGCTTGCCCTTGACAGGTGGGG + Exonic
1152437831 17:80286929-80286951 GAGCCTGGCTGTGCCTGCTGAGG + Intronic
1152637334 17:81435499-81435521 GGGCTTGCCCTTGTCTGTTGGGG + Intronic
1152986644 18:327452-327474 CAGCTGGTCCTGTCCTGCTGCGG + Intronic
1155057924 18:22201091-22201113 GACCTGGGCCTTGCCTGCTATGG + Exonic
1156757641 18:40548264-40548286 GAGTCTTTCCTTGTCTGCTGTGG + Intergenic
1158952803 18:62511027-62511049 GAGCTTATCAGTGCCTACTGTGG - Intergenic
1160812112 19:1017395-1017417 GAGCATGTGGGTGCCTGCTGGGG - Intronic
1161744063 19:6044179-6044201 GTGCTTGTCATTACCTGCTGGGG + Exonic
1163405152 19:17117363-17117385 GAGCTGGTTCTGGCTTGCTGTGG - Intronic
1163745522 19:19044180-19044202 AAGCTTGCCCATGCATGCTGGGG - Intronic
1165949958 19:39468840-39468862 GAGCTTCGCCATGTCTGCTGTGG + Exonic
1166710837 19:44936147-44936169 GAGGTTGTCCTGGCCTGGTTAGG + Intergenic
1167340650 19:48913851-48913873 GGGCTTCTCCTGGGCTGCTGTGG - Intronic
1167385487 19:49160683-49160705 GATCTTGTCCTTGGGAGCTGGGG + Intronic
1168112136 19:54199006-54199028 GAGCTCGTCAGTGACTGCTGAGG + Intergenic
925165615 2:1713903-1713925 GAGCTCCTTCCTGCCTGCTGAGG - Intronic
925783326 2:7404072-7404094 GAGCTTGTCCTTGCCCTCTGGGG - Intergenic
929052665 2:37851208-37851230 GTGCTTGTCTTTTCCTGATGTGG + Intergenic
930764708 2:55073215-55073237 GACCTTTTTCTTGCCTGCTGGGG + Intronic
933732277 2:85466199-85466221 CAGCTTCTGCTTGCCTTCTGGGG + Intergenic
933892056 2:86781160-86781182 GAGCTTGGTCTTGAATGCTGAGG - Intergenic
935280678 2:101515262-101515284 AATCTTGCCCTTGCCTGCTCTGG - Intergenic
935350467 2:102148031-102148053 GAGCTTCTGTTTCCCTGCTGTGG + Intronic
943390894 2:187266739-187266761 GAATTTGTCCTTGACAGCTGCGG + Intergenic
949026905 2:241770594-241770616 AGGCCTGGCCTTGCCTGCTGAGG + Intergenic
1169309467 20:4522512-4522534 TAGCTTGTCCTTGGCAGGTGTGG + Intergenic
1175247802 20:57592042-57592064 CAGCTTGTCCTCCCCTGGTGGGG - Intergenic
1176138387 20:63534898-63534920 GAGCCTGTGCTTGCCTGCGGGGG - Intronic
1176515914 21:7783286-7783308 CAGCTTCTCCTTGTCTCCTGTGG + Intergenic
1178649942 21:34413298-34413320 CAGCTTCTCCTTGTCTCCTGTGG + Intergenic
1180787450 22:18554768-18554790 GCTCTTGTCCTTCCCAGCTGGGG - Intergenic
1180796258 22:18607201-18607223 GAGCTTGTCCTTGCCTGCTGTGG + Exonic
1181225464 22:21388070-21388092 GAGCTTGTCCTTGCCTGCTGTGG - Exonic
1181234290 22:21440537-21440559 GCTCTTGTCCTTCCCAGCTGGGG + Intronic
1181244358 22:21494294-21494316 GCTCTTGTCCTTCCCAGCTGGGG - Intergenic
1181253169 22:21546743-21546765 GAGCTTGTCCTTGCCTGCTGTGG + Exonic
1182467627 22:30527212-30527234 CACCTTGTCCTTTCCTGCTATGG - Intronic
1183952591 22:41359865-41359887 CATCTTGTCCCTGCCTGCCGGGG - Exonic
1184305595 22:43599145-43599167 GAAATTGCCCATGCCTGCTGCGG - Intronic
1184468049 22:44680453-44680475 GGGCTGGTCCCTGCCTGGTGGGG + Intronic
1184779006 22:46636875-46636897 GAGCCCGTCCTGGCTTGCTGGGG + Intronic
1184940547 22:47761739-47761761 GAGCCAGGCCCTGCCTGCTGAGG - Intergenic
1184988394 22:48151771-48151793 GAGCTTGTTCCTGCCTCTTGGGG + Intergenic
954806465 3:53223718-53223740 AAGTTTGTCCTAGGCTGCTGGGG + Intergenic
954849125 3:53585617-53585639 GACCTTGTCCTTGTCTGGGGCGG + Intronic
958148053 3:89653053-89653075 GAGCTTTTCCATGCCTGCGTTGG + Intergenic
960791524 3:121436771-121436793 GAGCTTTTCATGGGCTGCTGAGG + Intronic
961347652 3:126274468-126274490 GAGCTAGTCCCATCCTGCTGTGG - Intergenic
961594260 3:128004784-128004806 GCCCCTGTTCTTGCCTGCTGTGG - Intergenic
963803706 3:149701798-149701820 GCCCTTGTGCTTGCCTTCTGGGG + Intronic
964474700 3:157088328-157088350 GAGTTTGTCTTTTCCTGCTCAGG - Intergenic
970248685 4:14091679-14091701 GAAGTTGTGCATGCCTGCTGGGG + Intergenic
976850191 4:89536157-89536179 CAGCTTGTCCTTGACCTCTGTGG - Intergenic
976956158 4:90902920-90902942 GATCATGTCCCTGCCTGCTTAGG - Intronic
980054046 4:128062436-128062458 CAGGTTCTCCTTGCCTGATGGGG + Intronic
984569767 4:181377665-181377687 GAGCTAGACTTTTCCTGCTGGGG + Intergenic
985653348 5:1117187-1117209 GAGCTGGGCCTGGCCTGCGGGGG + Intergenic
986556481 5:9014976-9014998 GAGGCTGTCCTTGCCTCCTCAGG + Intergenic
987623646 5:20369068-20369090 CAGCTTGCCCTTGACTGCTATGG + Intronic
987681580 5:21143327-21143349 GAGGTTGCCCCTACCTGCTGTGG + Intergenic
989150049 5:38290344-38290366 CAGCTTGTGCTTGGCTACTGTGG - Intronic
989335516 5:40312087-40312109 GATCTTGCCCTGGCCTGATGAGG - Intergenic
990729634 5:58794459-58794481 GAGCTTGGTCATGCCTGCTTCGG - Intronic
992084143 5:73262902-73262924 GAGCTGCTCCATGCCTGCTGGGG - Intergenic
993283208 5:85955776-85955798 GAGTTTGTCCTTGCCTGAGTTGG - Intergenic
996167377 5:120241794-120241816 GAGTCTGTCTTTGCCTGCTTTGG + Intergenic
997531173 5:134582065-134582087 CAGCTTCTCCTTCCCTGCGGAGG - Exonic
997824966 5:137098242-137098264 GAGCTTGTCCTTGGCTTGTTAGG - Intronic
999241505 5:150130484-150130506 GAGCTTTTTCTAGCCAGCTGGGG + Intronic
999309437 5:150542484-150542506 GAGCTGGTCCTTTCCAGCTCTGG - Intronic
999373185 5:151068661-151068683 GACCTTGGCCTTCCCTGCTCAGG - Intronic
1000225013 5:159252328-159252350 GAGCTTGTCCCTGTGTACTGGGG - Intergenic
1000524354 5:162337339-162337361 AAGCTTGTCCTTTGTTGCTGTGG + Intergenic
1003161887 6:3643114-3643136 GAGTTTGTAAGTGCCTGCTGGGG - Intergenic
1003612507 6:7626487-7626509 AAGCATGTCATTGCCTGCTTGGG - Intergenic
1006082226 6:31574221-31574243 GAGCCTTTCCCTGCCTTCTGGGG - Exonic
1008562010 6:52733041-52733063 GAGTTTCTCCTTGGCTGCTTAGG + Intergenic
1010060591 6:71618050-71618072 GGGCTAGTCCTTCCCTGCAGAGG + Intergenic
1010604548 6:77872277-77872299 AATCTTGGCCTTGCCTACTGTGG + Intronic
1011957726 6:93044129-93044151 GAGATTTTCCTTTCCTGATGTGG + Intergenic
1017551445 6:155512980-155513002 GAGTTTGTCCTGGCATCCTGTGG - Intergenic
1020381565 7:7553042-7553064 GAGGTTGTCCCTACCTACTGTGG - Intergenic
1022966709 7:35481040-35481062 GAGCATGTCCATGAATGCTGGGG - Intergenic
1026444132 7:70469524-70469546 CAGCTTGTCCTTGCAGGCTATGG + Intronic
1026564931 7:71481857-71481879 CAGCTTGTTCTTGCTTGCTTAGG + Intronic
1027139876 7:75649524-75649546 GAGGTTGTTATTGCCAGCTGCGG + Intronic
1030124836 7:106143903-106143925 CAGCTTGGCCTTGCCTTCTGGGG + Intergenic
1030598797 7:111570146-111570168 GAGAGTGTCCTTGGGTGCTGGGG + Intergenic
1035258036 7:157644410-157644432 GGGCCTGCCCTGGCCTGCTGGGG - Intronic
1035283438 7:157792024-157792046 GAGCCTGTCCTTCCCCTCTGGGG + Intronic
1035761691 8:2073276-2073298 GAGGCTTTCTTTGCCTGCTGGGG + Intronic
1037789150 8:21920564-21920586 GAGCTGCTCCTAGCGTGCTGTGG + Intronic
1041820113 8:62021944-62021966 GAGCTTATCCTTGACAGATGCGG + Intergenic
1042503443 8:69535163-69535185 TCGCTTGGCTTTGCCTGCTGTGG + Intronic
1043504933 8:80893333-80893355 GAGCTTGTCCATGCCTTGAGTGG - Intergenic
1050093850 9:2043379-2043401 GAATGTGCCCTTGCCTGCTGTGG + Intronic
1053181560 9:35976117-35976139 GAGCTGGTCCTTGGTTCCTGGGG + Intergenic
1055815179 9:80196525-80196547 TAGCTTAACCTTGCCTGGTGAGG + Intergenic
1056771852 9:89483272-89483294 TAGCTTGTCTTTGAATGCTGAGG - Intronic
1062363109 9:136196846-136196868 GAGATTGGCCTTGCCTGTCGAGG - Exonic
1185997926 X:4973638-4973660 GAAAATGTCCTTGCCTTCTGTGG + Intergenic
1186267366 X:7846714-7846736 GATCTTGTAGTTGCCTCCTGTGG + Intergenic
1186410135 X:9339609-9339631 GAGTTTGTCCTTTCCCTCTGGGG - Intergenic
1187098661 X:16170474-16170496 CAGCTTTTCCTTCTCTGCTGCGG - Exonic
1187512871 X:19938033-19938055 GAGGCTGTCCTTCGCTGCTGTGG - Intronic
1193995618 X:88363673-88363695 GGGCTGTTCCCTGCCTGCTGGGG - Intergenic
1195128399 X:101831205-101831227 GAGCTTGTCTTTGACTATTGAGG + Intergenic
1195203534 X:102572604-102572626 GAGCTTGTCTTTGACTATTGAGG - Intergenic
1199429334 X:147741119-147741141 GAGCTTGCCTTTGCCTCCTTAGG - Intergenic