ID: 1181226533

View in Genome Browser
Species Human (GRCh38)
Location 22:21394922-21394944
Sequence ACAGGCTTGTGCCACCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181226533_1181226534 -7 Left 1181226533 22:21394922-21394944 CCAGGGTGGTGGCACAAGCCTGT No data
Right 1181226534 22:21394938-21394960 AGCCTGTAGTTCCAGCACTTTGG 0: 11
1: 518
2: 18713
3: 245018
4: 286230
1181226533_1181226539 6 Left 1181226533 22:21394922-21394944 CCAGGGTGGTGGCACAAGCCTGT No data
Right 1181226539 22:21394951-21394973 AGCACTTTGGAAGGCCAAGGTGG 0: 1988
1: 60767
2: 149928
3: 159035
4: 96689
1181226533_1181226536 -3 Left 1181226533 22:21394922-21394944 CCAGGGTGGTGGCACAAGCCTGT No data
Right 1181226536 22:21394942-21394964 TGTAGTTCCAGCACTTTGGAAGG 0: 12
1: 829
2: 26482
3: 326403
4: 267184
1181226533_1181226540 10 Left 1181226533 22:21394922-21394944 CCAGGGTGGTGGCACAAGCCTGT No data
Right 1181226540 22:21394955-21394977 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1181226533_1181226537 3 Left 1181226533 22:21394922-21394944 CCAGGGTGGTGGCACAAGCCTGT No data
Right 1181226537 22:21394948-21394970 TCCAGCACTTTGGAAGGCCAAGG 0: 196
1: 7594
2: 98671
3: 219009
4: 234301
1181226533_1181226542 26 Left 1181226533 22:21394922-21394944 CCAGGGTGGTGGCACAAGCCTGT No data
Right 1181226542 22:21394971-21394993 TGGATGGATCGCTTGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181226533 Original CRISPR ACAGGCTTGTGCCACCACCC TGG (reversed) Intergenic
No off target data available for this crispr