ID: 1181226535

View in Genome Browser
Species Human (GRCh38)
Location 22:21394940-21394962
Sequence TTCCAAAGTGCTGGAACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181226535_1181226545 26 Left 1181226535 22:21394940-21394962 CCTGTAGTTCCAGCACTTTGGAA No data
Right 1181226545 22:21394989-21395011 CAAGGAGTTGGAGACCAGCATGG No data
1181226535_1181226540 -8 Left 1181226535 22:21394940-21394962 CCTGTAGTTCCAGCACTTTGGAA No data
Right 1181226540 22:21394955-21394977 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1181226535_1181226546 27 Left 1181226535 22:21394940-21394962 CCTGTAGTTCCAGCACTTTGGAA No data
Right 1181226546 22:21394990-21395012 AAGGAGTTGGAGACCAGCATGGG No data
1181226535_1181226543 14 Left 1181226535 22:21394940-21394962 CCTGTAGTTCCAGCACTTTGGAA No data
Right 1181226543 22:21394977-21394999 GATCGCTTGAGCCAAGGAGTTGG No data
1181226535_1181226542 8 Left 1181226535 22:21394940-21394962 CCTGTAGTTCCAGCACTTTGGAA No data
Right 1181226542 22:21394971-21394993 TGGATGGATCGCTTGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181226535 Original CRISPR TTCCAAAGTGCTGGAACTAC AGG (reversed) Intergenic
No off target data available for this crispr