ID: 1181226540

View in Genome Browser
Species Human (GRCh38)
Location 22:21394955-21394977
Sequence CTTTGGAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181226533_1181226540 10 Left 1181226533 22:21394922-21394944 CCAGGGTGGTGGCACAAGCCTGT No data
Right 1181226540 22:21394955-21394977 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1181226535_1181226540 -8 Left 1181226535 22:21394940-21394962 CCTGTAGTTCCAGCACTTTGGAA No data
Right 1181226540 22:21394955-21394977 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181226540 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG Intergenic
Too many off-targets to display for this crispr