ID: 1181228306

View in Genome Browser
Species Human (GRCh38)
Location 22:21405313-21405335
Sequence GTCTCCACCATTAGACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181228306_1181228312 30 Left 1181228306 22:21405313-21405335 CCTGCCAGTCTAATGGTGGAGAC No data
Right 1181228312 22:21405366-21405388 TGATCAGGAGCAGGAGACCCAGG No data
1181228306_1181228310 15 Left 1181228306 22:21405313-21405335 CCTGCCAGTCTAATGGTGGAGAC No data
Right 1181228310 22:21405351-21405373 TGGCACGTGGCAGATTGATCAGG No data
1181228306_1181228311 21 Left 1181228306 22:21405313-21405335 CCTGCCAGTCTAATGGTGGAGAC No data
Right 1181228311 22:21405357-21405379 GTGGCAGATTGATCAGGAGCAGG No data
1181228306_1181228308 -5 Left 1181228306 22:21405313-21405335 CCTGCCAGTCTAATGGTGGAGAC No data
Right 1181228308 22:21405331-21405353 GAGACAACTCTGAGATCAAATGG No data
1181228306_1181228309 2 Left 1181228306 22:21405313-21405335 CCTGCCAGTCTAATGGTGGAGAC No data
Right 1181228309 22:21405338-21405360 CTCTGAGATCAAATGGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181228306 Original CRISPR GTCTCCACCATTAGACTGGC AGG (reversed) Intergenic
No off target data available for this crispr